Description :
From Genome Similarity Track
Location :
Scaffold_144:14850- 16508
Transcript NameFunction/comments
Hyaar_Emoy2811025PREDICTED: nuclear nucleic acid-binding protein C1D-like

Sequence
1658 bases(100 bases per row)
CTTTTATACATAAAACGTGAGGTTGGTAAGGTGGGGAGAGGAGTGGAGGAAGGTCTAACATTCTCTATTGCACTGTGATTATCTCCCTAATTTATGATCA
TTTCAGTCTTTTTAAGATAATTATTATTGCGAGCCCGAAGGGTGAAGCCATTAGTGACTGTGCGCAAAGGTTGAATGCCGAGCTTTTAAATCGTACTTAT
CTGTGTGTGTCTGTCTGTATATAACGCGGTTAGGTGTACCTGACTCGTACTAAATACGATCTAGCCTGTCTCCCCTCATAGGTCGATTAGCATGATAGGT
GTCACTCTGTGGCTAGGTCAATATTGTGATGCACCTGATTGGCTTAAAATCGATTAAAGGTGAATATGATCACATAAGCAAATGCTGGACGCTCATACCT
AAAGGCCGATCGCTTTGCCCAAGAATATGTACTGTGTTAATGCACACATTTACAGCATCATACTCCTTCTTCAGTGACTGCTGCTGTTGTATAGTCTTTT
GCAACTTGATTCAGTTCTCCGAACTGAATTACTCATATCGAAGGGCGAGCTCCAGAGCTTGCTCCCCTATCTTATCTTTTATCGAGGGGTTCCACGTAGC
TAGTAGGGGTCGTCTACCTAGTCAGTCCCTTTTTTATTTTCGCTTTTTCATTTCGTGATTAAATGAGGCATTTTTATTTTCCCTATTTTAATCAGAACTT
AACACAAACCTGGAAAGTTAACTATGAATTCGGCTCCAATCAATTTACGCAATATAAAGGGGTGGGTGGGTGGTCAAAGAAAACCTGGTGGGTGGATAGC
TGGTGCCCTATTATGTTGCGATGAATGTTAAAATACGGATAGAAATGGCTAGCAAAAAAAACCTCCACGATTTTATGTCTACAGCATTGGACACCACAAA
ACAATGAACGAGCAAGTGCCGGAAGTCTTTGCCAGCGTGGAGCAGACGCTTGCAGCTGTGGAGGAGCACCTAGCCGTATTTTCAACGACTTATTTGGAAG
ATTTTGTTGCCCCTCTTAGCTATCTAGAGCGCGCGAAGGTGCAGGTTTCTTTGGGTACGTTTCGTAACGCGCTGACCGATAGCTATCTATTCAAAGTAAT
TTTATTTTTTAAAACGTCTATGACAACAGCCTACACAATCAATGCGCTACTATTTGTGTTTCTAAAGACACAGGGAGTGTCTCCTAGCGACATCCGTCAA
ACGCACGTCAAGCAAGAGTTGGTACGGCCGACGCTGCAAAACTGATGAAGTAGATGCTAACTATAGGAGTCGTATTGTTGTCATAGGAGCGTGTGAAAAC
TTTTATCAAAAAGATAAAGGACGCGGAAGAGCTGACAAAGGGTCCAAAATTGGTACTGGACAAGGGCGCTTCGAAACGATTTATCCACAACGCGCTAAGC
ACGGATCAAGTGTACGTCGACGCCGAGAAGGCGAAGAAGAAAGATCAGGATGGCGTCAAAGTGCACGTGCAGACGATAGGCAAAGGGAATCGGGCGGCTC
CTGCGTCAACGAGCAAGAAGAACAAGCGCCAGCGAAAAAAATAGCTAGACTGTGTCAGCATGAACAAGAACAATGTTGCATTTGATACGCTTTTGTCACG
TTATTATGCCTCGGTTTGGAGTTGTCATACCTTCCGGTGGTTTTTTTTCAAACATAAT