Description :
From Genome Similarity Track
Location :
Scaffold_680:1485- 7218
Sequence
5733 bases(100 bases per row)
CNNNNNNNNNNGCAACTAAGGACTTTGCCATGTCTGACCGTAGGGGGAGGAATGCTTATGAGTTGTCGCGGTCGCTTCCGCGGTGCGATTGCGATCAACA
TCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTTCTCCACCATATTGTAGCTGATTTCATACAGTTTTAACGTCCAAATATGTGAAC
ATAACAGGCCAATTCACTCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTGCGGATTACCGCCCATTCGATAGCCTAA
ACCACTATCACTAGTCGGCGATCCGGGTCAAAATGCCTGAGCACCGGGGTTTGAGCTAGTTTAGCTTTCAACATAGTGAACGCGATCATGGCTTTTCCCA
ACGATGGCCACCAGTATATTCGCCATTGGACCCTTCAGTTTTAGGGTGATCATGACCATTCATCGTTACCAGCTGGTGATCATGATCACCCGCAGGCATC
TACCCGTGGTCATCATCGATCTGGGTACTATGGTCGTGGTTATGGCTGGCTTCGCCATCATTCTCCATGTTGTGCAAACACATAATTTTGTGGAAATCAG
CTTCCGTCAATTCGTACAAGACGAAAGAATATATGGCAAAATCTTCAATGATCCAGCTGTAGTAATTCAGGCTTTCTAAGTAGGACTGCATTGACCGCAA
TGTTTGGGGAAAATGAATATTTAACAACAACCTTAATTCCTTCGGGTCGGCTTCTATTCCCGATGTTGACACTTAATGCCCGAGATACTCGACCTTGCGT
CATCCCCAAACACTCTTAGGTAAGCAGATCGACAAATTACACTGATCNNNNNNNNNNTGGTGCCCGATATACTCGATCTTGCGTCGTCCTCAAACGCTCT
TCGGTAAGCTGATCGACAAATTCCACTCATCACATACTTCCAACAACCTGTTCACCTTTAGATAGTGAGACGTCCAATATGACGCCGGGGTTAGAATGTC
ATCAATGTAGGACNNNNNNNNNNCGAAGGATTTCAGTGCGGGTTTTGCTCGCCGTCTGTAAAATCACATCAACTGGTTGAGACACCCTGTGGTCACTGAC
TTCCACCGATCCCCGATCGTGAGATACCCGTATAATGCATTATCCACCATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGT
AGATACACAGTCGTATAACCACCCCATTATTTTTCACAATCACTAAGATCGGCGACGCCCACGGTGAAGTTGAGGGACATATGATTTTAGCCAAAAGAAC
CCTTTGATCAGCTCCGCCAACTTTTCACGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCTTTTACGACAT
CTATGTTGCAGATGGCGCCTCGTGCGGCAGGTGGTGGTATGTTTCCTTTACCGATCAGAAGGTGTCGTTTCTTCCAGATCAGTCTTCTAGCTCCTTCGTC
AATGGTGCACCTGGGTTCGCCCACCTGTATGTCGTCAATTTTTACNNNNNNNNNNNNNNNNNNNNNAAGACTGCCATAGGTTGTACAACATCCTCTGCAA
ACAACACTACACCCTCATGATGATAAGACAAGCGTTCGCTTGCTCCTTCGCTAGCGACCTTTGTCATTTGGCTAGCCTGTTGGTCGGACGGTCGATGTAC
ATCACAATCCTTACTAGTGATCACGTCTGGGGGCTGGGTGGACCGGTCTTGCGTACGATCAGGTACCATCTCACTGATCGGCTCGGGAGTGAGTTCTTCC
TTACATCGTTTGACTGTGTTTCTGACTGGTCCTGCACCATCTTGACGTCCTAAATCACGTCGGGAGAAGTGTTCATGTCGACTAACAGTGGCAATCGCAA
CGATATTCCTCTCTCGGTTTCACTCTTTTGCTCCAGATGATCAGACATCCGATCCCAAACCCTATCACCGTCATCCCCTTCACTAGCCTATCAGATGTGG
TGATCACGTTAATAACCACCGGCGGTTGTCCTGACTGCGTTCTTTCAAGATTATCTTGTTTATCCACGTGATCCCATATCGGCCTATCACCTTTTAACTT
TGCTTTCTCTTCATCCATGGTCGTCTCTGATATATCCTTTGGCTGTCGTTTTACAATACGCGTTGTTGGCGTCGGATATGACAGGTGTTCAACCAACGGT
CCATCTACTTCAGGCAATTTTTTCTTCGTCTTCTTTCGTGGTCGCTTAAAACGCAAGTCTCTGCCACTTCTGATATCGCCGTGACCCCACGGACACAAAA
CCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGGATGATCACCTCCTAATCAGTCAGATTGGTCAAGCGAAG
GTAAGTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACCAAGGTAGGCTTCTACTCA
GTTACCCAACGGGATCGCCAAGTACTTCTCATCCGCGGCAATTCGTTGTATCTTCGCTTCATACGGTGGCCTTCTACCTTACAGTTGAATTCTGACTCCG
TCCACAAAATAAACTGTCCCTTCCGCCAGGTCAAGGCGTATCCCAGCCGGTACCATAATATCCATTCCTAGCATTGCTTCTTGTACCACTTTGTTACTAA
CCCATACATTAAAGTAGTAGACTAGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACCCACAAATTCCTGCTTCAGACTT
TTACCTATGCCTCAGCCAACCTTACGAGCAAAGGTGGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGCTTCGTCTCCTGAGTCAAACAAG
AGGGTGTTCAGCTCACTGTTGATTTCCCCCTGCCTTGGCTTGTCTGAAACACTTGTTTGAAGTATGATAATTCCAGAAAATACGTAATTCACCGGGAACA
ACTTAGGTTACATCTTGGTAGGTGATCGTGCGTCGTCATCCGGTCTTCGCAGAATCGCAATTGAAGGTAAACAACTAGAATCCAACTCATGTATAATGAA
AGTCCGACCGGTCAGGCAATGGACACTTTCATCAGCCCCTTCTCTCTCAATGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GTAAAACTTTTTCATCGAGCATTTGACTCCTTTGTGTACTTCTCCACACGCTGCGCACCNNNNNAAACATTTGCCAGAGGAATGAACTTGACGTCCGCTC
TTCTGGCACGTCAATCGTTTCCAGCATTTCCTATCATCAGGTATTGTCGACCCACAATGAGTGCACGACTTGTATCCCACTGCACGATCCTGCTCCCGCT
CCCGCTCACAATCACCCAATCTTGTCTTGGTCCGACGTTAATTTGTTCGATCCGTCGTTTGATCGGCTGTCGTANNNNNNNNNNCTGAAAACACGTTGTT
GCTTTTCTTCTTTGTCCGAACCGATTATATCTAATTTCGATGAACTGCCATCTCCCCCCACGTGGATTGCACGCACATCCCGGGCCAGTTTAGATAGACT
TGGGGTATATGGCAAGGCTGATCCCTGAGAGGAACCTGCTTGGGCTGGTCGGAAGGTTGCCTTTACGCTTCTGCGTAAGCTCGTTTGTGCGGATCATTTT
CTCCAATATATCCACGTCTTCCGATCGCAGCATCGTTATTTTTTCCACGAGGTCGCGATCGTCCAGTATTCCACATGGTCACGGCTATCGGCAGTGTTGC
CATCTATCACATGAATTTTTGCTCGCATTCNNNNNNNNNNNNNNNNNNNNATATTCTAATGGGGTCTCATTGGCATGCTTGCAGGCGTGGTACTAACTGG
AGACCAGCGGAGACGCCGCATCCACAATATTGTAAAAGGAAGCTCTCGAGTAAGTCATTCCACTTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNATTTCGCGCTGGGCCCGTTAGCAGATCACGAAAAGCAGCCACTTCTCCAAGTCAGGAGCTTGGTCATCCAGGAAAGCTGGCCCGAC
CTTCCGCAATAGAGGGTGCGGACCCACCCTCTATTGCGGTCATCATTGTGATCGCAGCCCGAAAATTGTTCTAACTCGGCAATCGCAGACATGAGAATTC
GTTGCGCTGCAAAGATCCCTCCTATTTTGGCCTTAGTAGTAGCCAACAGGGGTCGTCGTACATTGTCTAAATCTAGATCGTCATGGTCGTTTGCGTTGAC
GCAGCTGTGGTTCGAGTCAGCTGATTCCATGTCGGTGTCCGACATACACCCATTATGGTTGGGGGTGGGACGACCGGTCTACGTTATACGAGACGGTCGA
CGGTGTTGGTCGTGAAAGAACATTTCCATGGCTTTGCAAAGTAGCTTGGCATCTGGTCGGATTCATNNNNNNNNNNGGGACTTGCGTGGTGGTTAAATCC
ATCGCCATAGTGGTAGGAGCGGTAATTTCGTGGTGGTTACGCAAAAGTGCTACTCCAGAAGGTCCCAACGACATTCATTTGATCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNATTTCCTCCGCATACGACTCAGCAGAGGCATAGTGGGACGACACAGCCGGAGAATATTCTTCCTCTTTTCTTTTGGCAGTGT
TCGTGAGATCACGATCGGCGCTGTCTTAATTACCGCTCAGTGGGACCAGCGTGTTGAACAGTGATCGACTGGACGTGGTCACCTATAGCAGGTCGCAGTC
AAGCAAAACCTGCGTATCGANNNNNNNNNNTACAAATCCTGCGCCTTGTAGAATTTGAATGAGACGTTGTACCGCTTCCATATTGCTTGTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGATCAGCGCCGATTCCAAGATCGTGAGCACTGGATCTGTGGATAGCAAAGCTTGAAGCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCTTTTGAGCCTTAGCCTTCAATTGTTTTCTTCGTATATATTTTTGGTTTTAGACGAGACATGTCCTGATTTGGCTAAACGTATTCCGTCCAGCG
GGTCGTACTTCACAGTACGATCCGTGGTGGTCC