Description :
From Genome Similarity Track
Location :
Scaffold_1859:1485- 3476
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1859-snap-gene-0.5Tetratricopeptide repeat family protein

Sequence
1991 bases(100 bases per row)
GCTCCTTCTTGACTCTCTGCAGCCATGTGGACGCCTTCTGGTAGGACGGATTAAGCGCGTATGCCTCTCCGAAGCACGTGGCCGCGAGGTCGAGCTGGCG
CTTGCTGTAGTGGCAGAGCCCCATGTTGTGACTAGTGACGTGATGCTTACCCATCTCATGCATCGAGAGCGTGTAGAACGCAAGTGCGGCGTCGTAGTCG
TGGATCCCGTAGTACAGTCTGCCAATTTCGAACGCAATGTCCTTCTCCTTGTCGAGCGCGTAGTAGTTCTTCCACACGAGCGGGATGCAGTGCTTCACGT
CCTTCTTGAGCTTGGGCGGGCACGCGGGCGAGTGATCGAGCAGCACGTCACGAAACTTGTAGAAAACGTCCGGGTCCCAGCAGCTGAGCTTCATGAGTGC
GAGCACGGCCTTGAGCGTCGGAGACTTGGTGTCCTCCTTCATCGACTTCTGCATCACAAAAAAATCGTTGGGCCCAAACGCCGAGATCTCGTCCTCAAAC
GCGACGGTCAGGTTCGGAAACGACTGGCTTCGAGCCTCGCAGACTTTGTCGAGGTCGTCGTTGTACAGACTGGCCATCGAAGACGCTCTTGGCTCGTTCC
CACCGGGTAGAACGAACACGGACACCTTCAGACTCGCTTCTTCCTGCGGACTGTGGAGTGCAAAACCGCCGCGACTGGCAAAGTAGATGCCGATCGCGTG
GTAGTTGACCATGACCGAGAAGCTCCCGTGGACAGCGATGTGCGGGTCGCTTACGCCTCGGAAATGGTCCGGGTTGCTGTTACCCTTGTCCCCCGAGAGC
ACGACGAGTCGGTTCGACGACAGCGCGCTGAGCCGCTCGATGGCTGAGAGCGCACCGATGGGCACGAGCACCGTGGCCCCCGAGGACGCCGGGTCGTAGT
ACTCGTGGTACCACTTGAGGATGTTATTCAAGTGTGGCTTATCGTCCCCGTAGAAGCTCTCGTCGATCGGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCTCCGGATCGAGTGGGTCCG
GCTCAACGCTCTTCTTCGAGCCCACGCTGATGAGTCCCTCCTTGAGCATACCGTCCTCGACCTGGAACAGGTCGTGGTAGAGCGTGTCGAATAAATAGTT
GGCGATGATGCACAGCGGGTTCTTGAGCTTGCGCGGACGCAGTGTGACTTTGGACGAGAACAGGTGCAGCTCTGTGTCCTTGGTCGCGTCAAAGATCGCG
AAATCCACGATCCCGCGCTTTACAAAGGGCGCGAGCGCTGGGTGGGTCTTCCAGAAATTGAAGTTCTGCTCCGTGAAATCCGTCATGACGTACCGGATCT
TGTCGAGCGGGAAGTCTAGCACGCTCTATTGTATCACACACATCGAGACTTAGCATTCCCATGTTGTAGCAAGGCGTTGGGATTGTAGACTCGTACCTCG
GCCTCAGCGAGTGCCTTAAGGAAGTAAAAGCTGAATTTGCCAGAGCCCGTGCCGAGCTCAATGATGTAGAACGGCTCGGACGTGTCCAGCTGTATCACCA
CATCCACACAATAAAGTGGTTAGATCTCGTACAGTCTAGTCCATCTCCAGCAGTGACACTATAGAAAATATATACTACGTACCGGGTGGTCGCTTGCAGC
GCGCATGACGTCGCGAAAGTAGGCGCGCAAGACGTTGCTATAGCGCTTGGCGATGAATGTGTTGGACGTGATGAAGTGCGGCACGATGCCCTGCGCCCAG
GACTCGACGCCCTCGCGGTCGTAGAACGACATCATGAGCTTCCACAGGTGGCACTTGGAGAACTGCGTGTAGTCCTCCAGTTGGCATCGTT