Description :
From Genome Similarity Track
Location :
Scaffold_2373:1485- 2711
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2373-snap-gene-0.16-phosphofructo-2-kinase/fructose-2, 6-biphosphatase

Sequence
1226 bases(100 bases per row)
GTGGGAAGATGATCCTGTTCCTTGTCGGTCTGCCTGGTCGCGGAAAGACATTTATTGGTCACGTGCTCGCGCGCCATTTGACGTGGATGGGGCACCAGTC
GAAAGTGTTCAATACGGGCGAATACCGCCGCAAGCTCGTTGGTTCGAACATGAACCACGCGTTCTGGGATCCACTGAACGAGGAGTCGTCTCAGATCCGC
TCGGACCTCGCCAAGCAGTGCCTCGAAGACTCGATTGTTGCGCTCGAGAGCGACAACTGCGATTGTGTGATCTTTGACGCGACGAATGCGACGCGCAATC
GCCGCACCATGCTCCGCGACGAAGTGATGAAGCGATACAAGTGCGAAATGATGTTCATCGAGTCCATCTGCGAATCGCCCGAGCTGATTGCCTCTTCGAT
TAACGAGATGAAGCTGAACTCGGAGGACTACGCGGGACAGACGATGGAGGAAGCGGCGGAGGACTACAACAACCGCATTCTGCACTACCAGTCGGTCTAC
CAGCAGCTGGACTCGGAGCTGGAAGACGTGCCGTTCATCAAGGTGATCGACGTCGGCCGCCAAATCTTCTGCAACCAGATCTACGGGTACCTGCAGTCGC
GCATCATGTTCCTGATGGCGAACCTGCAGTTGCGACCTCGCCCGATCTGGCTGAGTCGTCACGGAGAGAGCATGTTCAACACGCAGAAGCGAATCGGTGG
CGACGCGCCTCTGAGTCCGCTTGGGCAGCAGTATGCGGTTCAATTAGATCGGTTCATCGAAGCGTACTACCCGACGCCAGACACGGAGCTGGCGGTATGG
ACGTCCACCATGCTGCGAACGGGCATGACTGTGGAGCGAATCGCGGCGCGCGGTCGATCCGTGGTCAAGTGGAAGCAGCTCGACGAGATCGACGCCGGCG
TGTGTGACGGAATGACGTACGAGCAGGTGGCTGAAGAAATGCCGGAGGAGTACTTGGCGCGCAAGAACAACAAGTTGAACTACCGCTACCCTCGCGGCGA
GTCGTACCAGGACGTGATCCACCGCCTGGAGCCCGTGATCACGGAGCTCATGCGCATGGACCGCCCCGTGCTGATCGTAGCGCATCAAGCCATCTTACGC
GTTCTCTATGCATACCTGACGAACAAGGCGCCGTCCGAGTGTCCGACGCTGAACGTGCCGCTGCACGTGGTGATCCAGCTGACCCCGAAGGCGTACCAGT
GCGAAGAAGTGTGGCACCGACCAATG