Description :
From Genome Similarity Track
Location :
Scaffold_275:14847- 16537
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_275-snap-gene-0.8Ran-binding protein 9

Sequence
1690 bases(100 bases per row)
CTAAAGACTTGCACAGAAAGCCTCAATGTCGAAGCGGAAGGGCACCGAGCCGACATTGAGCGTGGCCGCGTCGCCGTACGCGTGGAGCGACACGGCCGCG
GCGTATTCCCCTTTGAGGATCGCCACGGGCGCTATTCCCACGAGTGTGCCGTTGAGCGTGAAGAAGAGCGCGCCGGTCGTGCGGTTGAGGCCACAGCCGA
CCGTGAACGTCGCAGCGTCCGCGTCGCTCTGGGCGTCCACAGCGCCCCAGGCCGGGCCCAGTGGGGTCCACTCGCCGCCGTAGGCCGCGCTGCCGTCGTT
GTAGACAAAGTCACCGTCGTTGCCGTGGTAGCCGTACGATACGGACTTCCAGCCGAGGTGCTCCTCCGAGCCAAAGCCGTACGCATTGCGCGAGTTCTCG
TCCGAGAGCGACACGACGCCCACGCTGCCGCAGCCCTTCATGGACACCTCGAAGTACGACAGCTGCTTCTGCAGCGCCTTGGCGCACGGCAGCACGGGCA
ACGCCTGCGTGCTGCGGAACGAGTCCACCGACCCGCGCGCAAAGCTGCGCAGCATCGAGTTGTTGTGGACCTCGTAGGTGCCGTTCGCCGCGTTCTGCTT
GACCGCGCTGCGCGTCGCGAGCGGGTACTGCAATTGCGGAGACTTGCGATCGCGGCTGCGAACCATGGTCAGCTGGTTCTGGAACGACGCATCAAAGTAG
GCGCCGCCCAGGGGCGCAGCAGCGAACGGACGCCACTGGTGCGAGTAGAGTGCGAGCAGCAGGCGCTTGGACTCGGTAATCACGTGGCGGAACTCGGCGC
ACACGAGCGTGCCGTTGACCAGGTCGTCGACGTCCAGGAACTCGAGACAGAGCTCGAGCGTGTGCATCTCCAGGAACTCATTCTCCTGGTTCTTGTTGGC
ACCAGCAGAGCTGCTGGCGTTCTTCTTGAGCTGTCGCTTGCGCGCGTTCTNNNNNNNNNNTGCTGCTGTTCGAGGAGCACGACTGTGCGCAGGTCGTGCG
AGAGCTGAGGATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCGATGCGCGGACCACGGGGCCCGCTGCTGTAGTT
CAGGTCGCTCCAGCGCAGCTCGCGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACTTCCACTGGTCGGCATGCTGGTCGTCGGGCCGATCAGCTCCTGCTCGTCGTCGTCGTCGTTC
TCGTCCTCGCTGGCCGTGGAGCTGGTGCTGNNNNNNNNNNCGCTGCTGCTGCTGCTGTTGTTGTAGCGCGACGTCACGACCGCGTACAACTCGTACGCCA
TGCTGCAGTCGAGCGCCGTCGGGTCCCACTGGTCGTCGTCCTCGCTGGCCGTGGAGAGCTGGTGCTGCTGGTCGTGGAGCTGGTGCTGCTGGTCGTGGAG
CTGAGGCTGCAGGCGCGTGTGAAGCGGGCGCAGCGCGGCGCCTTGGCGGTCAGCACGACGTAGCCGCGCAACTTGTTTGGTTGGAGCTGG