Description :
From Genome Similarity Track
Location :
Scaffold_95:14845- 16156
Sequence
1311 bases(100 bases per row)
TCGTCGTATTGATCACACCACTCGCATACTCACCGAACAGCTGAGCGAGCATGTAGGCCACTAGTTAATCAGTCGTGCCCTTATACCTCCACGAGGTCGT
TTCGTCAAGGGTCAATATACGACAAGGCACTGGGCTCACAACGTATTAAGTGCTGCTGCCGCGATGCTACCATTTTTGCGTGGGAAGTTTTGCATGCTAC
GCTGAAGTTCACATAATGTTTACAGTCTTACACACATAATGGCAGGCATCACACTTGTGTGGAATCGACAGACACGTGATTGCTACCGCATTAGCGACCA
TCCTTTCCATATGCTCCTCTTGTCATTCACAATCAAGTGAGATGAAGATGGCCCGTCATAACCGTTCTACAGTATACATAAGTGCAAGACACATATCTAA
TAATGTTGTTGCTTTCAGAGTGGACGAGGGTGGGAGCTGGCTTCGAGCACCGACCGGATTTATTGATTGATATAGCTGAGCATCGAACTTTGACGACATA
ATGCTTGGTTGTGTTCTGGCCAAGACAAGAAGCAGGTCAAACTTTGATAGGGCAGTAGCTTGGTCATCCGACTGGTGCGAGATCGACGCAAGATTTTAAG
CTGAGCGTAGATCTATTATTGTAGACACGTGTGGTGCGCTCAAGCAGTGTAACGGCACAGACCGTAGACCTTTCCTCCCTCAATTTATAGCAGGACGTCC
TCGTTGGCTGAAATGCGAAGGTGTGTGGCTTGATCGCGCTCAATCTTCAGCATAAGCTCCACCAAGGAACACGAAGTTATCGTACCGTATATAAGCGATG
TGCCCTGATTCATGTTTCGATGACATTATTTGTAGAGTTTAGACTACCTAAACAACCATTCAAATATGATAGCAGTCTATCACTGAGAAAGAGGCTCAAG
ATCGAACGAAGCGTTGAGCTGAAGTGACAAAGCACTAATGCATCCTGTTTAAGTTGTCATTCAATCCAGAACTTAGATTGGCTTGTACTATTATTCCTAA
CTTTCCCTGTCATCGGGTGAGCTGTAACGTGTGCTTTTTCCGCCTTCTCCTTTTACACGACAAAGGATTTAGATGCTTGTAATCCTGCATATACCGGTCG
AGCGATGCCGTCTCCCTCTCAGTCATCTTCTGTCCTTCGACATTCATCCAAGCGCTGACCTGAGCTAGGTCACCCCTTTGTCTAACCAGCAGGTTAGCGC
CTCTTGCAGACGCGCGGCCTCAGTCTCTGCTTCCTCAGTACGTGCTGCTGTAGAGACTATCTTGTTGAGTCTGTCATCGCCGTAGAAAATGGTCAGGGTC
TCGACCATCGT