Description :
From Genome Similarity Track
Location :
Scaffold_147:14842- 27323
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_147-snap-gene-0.8Gene of unknown function
Pytar_ATCC12531maker-par_contig_147-snap-gene-0.9Pc20g01730 protein

Sequence
12481 bases(100 bases per row)
TCCAAGTGTGTGGCTGCAAGTTTCTCCAGTTCATGGCGTACGAAGAGTCGGCGAAAGAGCGGATCATTCACCACCACGGCATCGAGGCGGTGCTGGACGC
GCTGGATTCGTTTGCGACCGACGTGCAGCTTGCTACAAGTGCCTCGGATTTGCTCTACTTCCTCAGTCTCGACTTGGAGAATACGTTCGCGTCGCACGAA
TCTGACTTGATCGCCATGATGCAGGCGATCATGGACCATGTCATCCGGCTCATGAGAACGCACCGCCAGCTCCAGCCTGTACAAATCCACGGCACTGCAG
TCTTGCTCACTTTCGCTGGCTCGCAGGCATCGTCACGGCTCTATCTCAGCCAGCACGGCGCGTCGTCGTCTCTGTGGGACGTCGTCACAGTGGCGGTGTT
CGCGAGCGACGACGCCGCTGCAGACACGATCGACTTGCTGCAGCTGATCCTCGAGACGCCCGAGTGCTATGAGGCTCTCCAAACGAGCGTGATGATAGAA
AGCACGCCCAGGGATGCGAGCGCCCAAATGTGCACACTGCACTGCATGTCGACGCTCATCTCGTGTTTGGAAAGCAAACGCAATCGATCTCAATACGCCG
ACAAGGTCCGCTCAATCGCGTTCATTATCGACCGTATCCAGAGCCTCGTCGAGAGTACCAAGTCGCCGCCATCCCCGTCTCCAGTCAAACGCGTCACTGA
GAGTGATGAGGAGAAGGCCCGCCTTCCGATCCGACCGCATCACGCTACCTCACGTCAGCTCATCCACACAGACGACGACCATGACGACGGAGAGAGTGAG
GATGCCCACCGCTTTCTGGGTGAAGACTCCCCAACGAAAACAGAAGGCGACTCGTCCTACGGGTGTTTCGACGAGTTTGTTGACGACCACGAGGATTCGC
ACGATGACGCAGACAAAGCGGAGGCCGGAGAGCGAGTCACCAGCAGTAGGAGAGACTCGACAGGGATTTTTCATCGTACAGGGCACAGCAACGACGACGT
GTCTCCGCCACGGAACTGGCAGCGCGAGTGTGCGCTCGCACGAAGAGCCCACCGAGAACTGGACTGCGAATACCAGTTGCTCCAGGCAAACTACCAGATT
CTGCTGCGCCGCGCGCAAGAGCAGTCCAAGCTGCTCAACATCCAGAACGCTCGCATCCAGCACCACGCAGACGTGCACCAGCGCGTGCTCGAGCGTGTGC
GGACGCTCGAGACGGCGCTGGCCGACGCGCAGCGCAAGCACCACGTCGAGCGGGAACTGCGGCTCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNAGTCGGAGAAAATCGCGCTGTCGCTCCACGAGGCCATGAAAGAAATCTCGACGCTGAGCAAGCACAACTCGACGGCGACCCGCGAGCTCCGGGAAAAC
GAAAAGTTCCGCGTCGACTACCAGCACAAAGTGTCGGCCGTGCGCCAGCAGCAGCAAAAGCTCGAGTACGAGCGTGATGATGCCGTAGTCCAGATGCTCT
CGATGCGGCAGGAGCAGCTCGCACTCAGCAAGCGGTTGGATGACTCGCGCCGTGAGGCTGACGAGGCACTCCAGATGCGAGAGGAAGATGTGGACGCGCC
GAAGCTGAGTGCGTTCAGCGAGCTGCTGAGCCGGTCGCCGTCAACGGNNNNNNNNNNNNNNNNNACTCCGCCGAGTCTCGAGCTACACGCTCACGACCAA
GCGCGTCACAGCTGAGGCCAGCGACCGNNNNNNNNNNGCACCGTAAGTCCATGTACGCCGGCTCGATCCAGAAGAGCGCGGGCGTGCGGCCAGCGGATGC
CGCCACGATACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCGCTAGTCTGTATGGTGCGGACCGGTCCAACCGG
TCGTCCAATCTCATGGCCGTGGATGGGGATTTCCAGCGAGAAGACGAGGAGTCGACTATGGAGCCACCCAAGGATGACGCGACGGTCCCCACGGGCTTCG
GCTCCTACCCGTTTCCTCAGCGTGGACTCGACAGGATGGAAATTGAGCGCACACTGCGCGCCGTGTACGATGGCCTGGACAAGTGCGCCGAGGGCGGCGT
CCACCTCGCGACCATCCGGCGGTTCTTTGTCGACTGCGGCGTCGTGCAGCCGCCGCTTGTCNNNNNNNNNNNNNNNNNNNNNNGGCGACGTCGACACGAT
TCTCACGCGCGTCTTGAACCAGGCGCAAGAGAACCGCCGGCGAGTCATGGTGCGCAAAGACTTTACAGTCTCCACAATCCCCGGCGGCATCGGCAGCAGC
AGTCTCCAAAAGAAGGCGACCGAGGCCAAGCGGTTCCGGTTCTTTGACGAAGAGGCGTTCTTCGAGGCCGTGACGCTGCTCGTAATGCGGCGGTTCCCTC
ACTTCGAGGCCAAGAAGGCCCTCGAGGTGTTTATCACCGAGTCGCTCCACCCCATGCAGCGCCAGCAGCAGCAGACCCAGTGGATACAGCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGCCTTGGCACCAGCGGCGGCAGCACGTCGCCGACCG
CGGCGTGTGTCGGCATTTTGAAGGCCTTGCTCAATAGCCTCGCGTTACACGTCGGTCGTGACGCTGAGCCGCAAGACTCCACAACGACCACCCTAACACC
GGCGACCTCGAGCTTGCTCCGCCACGCGATGCCTCGCAAACCACAGCGCGAGGACGTCGTGTACGCCATGCTCGAGATGCACGCCGTGCTCGCGCGCGAG
TACAAGCCGCTCGCGACCATCTGCGAGTTCTACAGCGCGCTCCACCTTCACCACCACGCGCTGCTCAAGGACGACTCCATGCCGCTGCCGTTCGAGTTGC
TGCTCGCGTTTTCCATGGACTTTGAGATCATCCCGTCCTTCATGGACCGCCTCAGTCTCAAGCACTTGCACGCCGAAGTCAGTGGGTACTTGAAAGCGTC
CCTGACGCTTCAGAAGAAAGCCATGTCGCCGAGTGCCGTCGACCTGGAGATGCTCAAGAAAGTGGCCTTCAGCATGCTGGTCGCGCGGCTCGCGATGGAA
CTGTTCAGTGCCAAGCGCGAGTACGAGACGCCCGAGAAGCAGATCTCGGCGCTGCTGCAGTGGCTCGACAACTCGGCCGGGCGCGACAAGATCCAGAAGA
AGGCCATGCTGCCCGTCGTCATTAAATTCTCCCGCAAGCTCTACGCAATACGACCGTGAGAGTGATAGTGAAGAGATCCAAATACTTCGAGTACAGTACA
CGAGGCGGACTCTGGGCGTGGATTTCATACTCTCTATTGTACAGTCCACGGGAACACAAAGGAGGGTCAACGACCCACTACGCGGCGGCCGCGTCCTCGC
GGTCCCGCACGAGCTGCGCGATCTCGGCGTTGGCCTGGAACCGGTCTTCCAGCGTCAGCTTGTAGTACGATTTTTGCGTCCGCTGTTCCCACTAAAAGAC
ACGAACCGTTAGTGACCCTCTCTCTCTCTCTCTCTAGAGGGCTTTCATCCAGGGACGGACGTACCATGCGCACGTCTCGCACCGAGTGCTGCCGCGGCTC
GTACGTGTGGTTCGCCTTGAACTTTTTATTGTGCTTGGCGAGCAGCGCCTGCAGGTCCTCGAGGTCCTTGTCACTGTGGGCCTTCGCGACCGGCCTGCCG
CGGCTGCGCGCCTTGCTCGCCTCGGTCGATCGCTCGGCCACGGGCCGCTTGCGGGGCAGCGTCTGTGTGTTGCCTTTAGAACCCACCGAGGACTTGGTGT
TACTCGCCGAGGTCGAGTTGCCAAACGGCAGCTTGGTACTCGCCTTCTTGACAGCCGTCCCGCCGCTGGTGGCGACGGTCTTTGCCGTCGCGCTCACTGT
GCGCATGGTCGCCTTGAGCGTCCCCACGGGCGCCGCGTCCACGTGGCCGCTGTACGCCANNNNNNNNNNTGTACGCCACGTTGCGGCGCTTCAACCGCGT
GGCGCCGCCACTGGCGCTGGCGCTGGCATTCTCCTTTTCGCCGTCAGCGTCGCTGTGGTGGTGCTGGAACGAGCGGTGGAANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCGCGAGAAACTCTTCAGTCGGGCGGCTGTGGGAGTCGTGGACGAGGTCG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTTCTCTCTTTTTTCGGCGCCCTTTTCGGTTGGTGCGGTTGACCGAAGGTGAGCGGGTTTGAACTTCAGATTGCTCCCACAACCTTCGTACG
ACATGCATCAGGAATGATGTGGACCACGTCAGTGTAGCCATATCCGTCGCTGCTGATATTTTCTGTCTTCTTTATTCGCGCCACTGCTGACAGCCTGGGC
TACTACTATNNNNNNNNNNGCCGCGAGAAACTCTTCGGTCGGGCGGCTGTGCGAGTCGTGGACGAGGTCGAACCACGCGTCGTGGACGCGCTTGCCCGTG
ACCGTGGCGTACCGCGGCGGCAGCGTGAGGTCCGCAAAGATCCGCGGCACGTCGAACTCGAAGAGCGGGTCGATGCCGTCGGCGCTGAGCCCCATGCCCG
CGCTCAGCCGCTTCTTGGGCTTGGTCATCATACTCCGATTGCTTTCTGCTTTTTGGCGCCCTTTTCCAAGTAATAAGGTTGACCGAAGGTGAGCGGGTTT
GAACTACAGATTGCTCCCGCAACCTTCGTACGACATGAGGAGGCCCTCATCGTTCAGATTACTGAAACTACCGGTATTCTTTAAAATACCGGTAGTCCAT
TAAAATGGAGGTGCGATTTTCCCTCATTTAACAGTAAGGTGGTCTGCTCATACATATACTGTATTTACTAAGTCGGGAGCTATATATACGATGTTATGTT
TACCTACTCAGGCCCATCATGTTGCAGCGTCGTCACAGCCCACCAAAGTGACTACGCCCCCTATTGATCGCGAGGCCAGAGATGCTGTGTTGCTGACCAC
AGCAAACCCACCGGACGCACCGCACTCGCGTCGCTCNNNNNNNNNNCCAAGCCGTGAGAGGGCTCCTCGTCGGCTCTCGCGTTTCGCGTGGTTTTGAGGC
TTACCCGCGGTCTATCTACTTGACAAAGTAATCTGCATTCATGTAGCAATGAGAAGCCGGATAAAGTGCAGAAGCAACCACCACACTTATCTTTGGTCAA
ATCTCACAAGTCGTGACCGTTTGACGGGTGGTCACCAAACACGCGTTAGGGCAACGCTTCTTTCTTGATTCCACGCTTCTCGCTCGGCGGAATATACACG
AGCAGACACGCCACGGCGTAATAGTGGCCAAGGTTGTGCTCGTTGCCGTACTGGATGCTCGTCTTCATGTCCGGAAAGATGGACGGACGCACGACCCACA
CGATCTCACGAGCCTTGTGAAGTTTCAGCTGACTGAAATCCAGGTACGTAGGCGGACCATAGTCGAGGCCGTCTGCTGGACGCAGATACAAGCTCCAGTC
CGAGATGTAGAGCCANNNNNNNNNNTCGTCGCCACGCCACTCCCCTTCAGTCGAAGGATCCGCTCGTGTCGCTCACATCAATTGTGTTGACTAGGTGTCT
GTCGCATTGATTAAAAGTTCCTGGCATTGGTAGGTTAGGTCAGTATCCCATCTTCAAGCAGGGAGATTTCTCCACATGTACCGAACAAGCGTTAGCATCG
ATCAATCCAAAAGGGTGACGTCGCCGGCATGGATTAACGTTCCACGTCCTACAGCTAATGCTCGTCCGATACCAGAACCAATGGTTTGCGACCAGATGAG
AGCCCTTACAATCAGTTGTTGACCCTACTGTGCAGATTCCCAGCATGCAAGGAACACTTTCAGCCACGGACAAATGAGGTCTCACAAGCAACATGTAACA
TGTCATACGTAGCGGTTCGAAAACCTCACCTGGCCATGTTGCGGCGTGGGTATGCTTCGACGATCGTCACAGCCCGCCAAAGTGAGCGCGGTGCGGGATG
AGCATCAGACCAGGAATACTGTGTTGATGATCACAGCAAACCCACCGAACGCACCGCACTCGCGTCGCTCCGACAAACAATAGAATGTGGCGCACCAGCG
TCTCATCCAGGCAGCCGGACACACTACACTGTCGAAAGCGGCGTGGTCCCTTCCAGATCCCCTCCTTGACTCTAGTGCCGCGACGTTCACCATAATATCC
AACCACGCTCAGCAAGCCTATGCCAACGCGACTACACTCATTCAGAACTTGGTCTTGGAACCGCTCCAGCAACGTCCGAGCCGATTCTTTCCACTCTCGT
GCCTTTTGTGGNNNNNNNNNNGCACTCATTCAATTCTTGGTCTTGGAACCACTCCAGCAACATCCGAGCCGATTCTGTCCACTCTCGTGCCTTTTGTGGG
TAACTGCTGTATCTCCCGTAGGCGTCTTCCTCGGCCCGAATGTACACTGTCTCCAAGACAGAATTGGTGGCAAGCATGCGCGCAATGTCTGAGACACGGA
ACACAGGCCAGAGCGTATGATGAGCTGTCACAAGACAGAGGTGCCGCAGCAAACGCGCGCCTGGGTGGGTGGGATCGGACAACATCGCCAGCAGCGGTAG
GCACTCCGTGTCACGCATATACCTGTCGCCATAGGTGACAACCACCACAAGCGATGTAACCCGACACGGCCGAGACACACNNNNNNNNNNACCTGTCACC
ATAGGTGACAACCACTACAAGCGATGTGACCCGACACGGCCGAGACACACTCGCATACGCATCAACCAACGGCTGCAGCGTACGCACGCCATAGCGTATG
AGAACCAGCGTCGCAACGTTTGGGCAGTATCGCAAGATCAGCTCGAGGTCGTCGCCGATGTTGGGGCGCAACGGATTTTGAAAACCCGTCAACGCGAGCG
ACTGGATCTGCTAGCACTCGAGCCAGCGAAATATTGGAACCCCGGACAACATACTGTGAGCGCGATCAATCACATGTACCGCCGTCAATCCAAACAAGCG
CGCACCGTTCGTACTTCTCACTTGTTCACTTTTGAACGGCTCGCACTCGATGCGGACACCGTGGCGCATCACCCAGCAGAGCCCACACCCGCGAACGATG
ACTCCCACAACTCCGAGCTGTGCNNNNNNNNNNGTGTACCACCGTCAATCTAAACAAGCGTACACTGTCCCTACTTCTCACCTGTTCACTCTTGGACGGT
ACGCACTCGATGCGGACACCGTGGCTCAGCACCCAGCAGAGTCCACACCCGCGAACGATGGCTCCCACAACTCCGAGCTGTGCTATCCGCACGACAGCCT
CGAGTTTTGTATCTACTGCGACGTCCAAAACCGGCCGTCCTCGCAGATAAGGATCAAGAAACGCTGCTATCGACTCGATGATGACACGCGCAACAGCCGT
GCCAACCACGTACCACTCACATGATATATCATGCGTCTGGGATTGAGTCGTCGCTACTGCAATCGCAGCGTGAACAACAGATTTCAATGGGTTCTCGGAT
CGGCGCGCCGCTTCGAGTCTTGCTTCCAGCACGGCGTCAGTTGCGCCCGTCTCATCCACCGTCAGCATTAGCTCGGGGAGATCCTCCTCCCGTCGCAGCG
GATGCGAAANNNNNNNNNNACCCGTCTCATCTACCGTCAGCATTAACTCGGGGAGATCCGCATCCCGTCGCAGCGGATGCGAAAGTCCGTACTCCAACCA
ACACCACTGATTCGCCTGATCGTCATCCCCCGCGTAAAAGCAACTCAACGACAGACTCTCGAGACTCCACGCTCGGGGCAGCACCGAACCCACTGCCGCG
AGCGTCGGTGCGACCGCACGCTTTGTCACCCCGGTAAACAACCGCAGCGTCTTGAGTGTCTTCAACTCCACCAACAGCGAGCGGAGCAGCACTCCAAATA
GCCCAACTTGGTTCGTCGTATCGGCCTCTCGCACGAGTTGCAAATTCAACGTGATGCATCTGACAGAGCGGNNNNNNNNNNGCGCTTTGTCACCCCGCTA
AACAACCGCAGCGTCTTGATTGTCTTCAACTCCACCAACAACGCACGGAGCAGCAATCCAAATAGCCCAACTTGGTCCGTCATATCGGTCTCTCGCACGA
GTTGCACATTCAGCGTGATGCATCTGACAGAGCGGCAACCGCACAAGAGCTGCTGCATTGCTTCGAGGTTGCTAGAGTGTAGGTAGACACCGCGCTTATA
GTCGGGATGAAACGCGATCGACAGCTCGTGCTTGGATGTGGNNNNNNNNNNCGCTTCGAGGGTGCTAGAGTGTAGGTAGACTCCGTGCTTATAGTCGGAA
TGGAACGCGATTGACAGCTCGTGCTTGGATGTGGGGACTGAAGTTGATGTAGCTGACCCTCGCAAAAGCTGCTGTAGTGGTCCCTTCGCTGGTCGCGCGC
AAGTCTCACGTCCAATTTCACTGATGGCGTTGATGAAAACCGGCCACTCAGGTCCCAATAGCTCTGGAGGTTGAACGGAGTGCCACGGGAGAGCCNNNNN
NNNNNCCGCGTCCAATTTCACTGATGGCTTTGATGAGAACCGACCACTCAGGCTCCAATAGCTCTGGAGGATCAACGGAGTGCCACGGGAGAGCCGTCGC
ATTCGTCGGCACAATCAACTCGAGATGAAGCACGCGAATCGGTCTCACAACGAGCCCATTTCCAACTAGTTGCTCCATCATCACGCGTCGCCGGTGCAAG
ATCCAGTCGGGACACTTCGACGCTGCNNNNNNNNNNCAGATGCTCTACTACCACGCGTCGCCGCTGCAAGATGTAGTCGGGACACTTCGACGCTGCGTCC
GTCCACGTCACTTGCCGCCACAGTTCTGTCAATGTGTTCTCAAACCCGGATACTGGGTATTCCTGGAAATCGATTGNNNNNNNNNNAGTCACTTGCCGCC
GCAGTTCTGCCAATGTGATCTCGAACCCGGGCGCAGGGTATTCCTGGAAATCGATTGCGAAGCACGAAAACGCGGCGCGGTCAAACGGCAGCATCACATG
CGGCGGAGGCTGAAACAAGAACTCTTTATAGCGACTGCGCCGCGGATCATACTTGTCTTCAGAGTACTCAATCCAGAGCTCGGAGACAGCCGTGCGCCAG
AAACGATGGCTTCGGTCCGGCGAGAAGCCCCAGCACGAGCACAGTGCGTTCACAATGTCGATCGCGACCCGCAGCTCATAGCCCAGTCCACTGGCGAGCT
CGCCGTCGGTGACCATCACACAAAGCAGCGACATCCACTCCTGCTTCATGACTGCGCCGTCTGTCCGCGACGTGTCGAACACGAGGCGTCGCCGCAGGAC
ACTGCAGTGCGTGCGCAGCAAATGCAGGGCATCGTGCTCAGAGAGCAGCGCTGGCATGATGAGCAATACTGGTTATCAGTGGTTGGGTGGGACAAGGCGT
GTTCTCCACGGCGGTGTGGTTCTGGATATGAAGAACACGGTGCAGACATATCAACGCTTGAACTGGCGACAANNNNNNNNNNGAGCAATACTGGTTATCA
GCATGCGGTTGGGTGGATTGATGGAGAACACGGTGCAGAGACCTCAACGCTTGAACTGGCGACAATCCACCAATCAAAGCATTTTGGTGTGGGTTTTCCA
CCAATGCGAAGGCGTCATAATCTTACGCCCCTACCCCTGTTTAACGGGGTGATGCAGAGCGGCATTTCTCTCCTTTTTCTCGTTTCTCCCGCTCGCAGCC
AACGGCCATCCACTTCTTCACTTCCCCACTTTCCAATCTCCAGGTCAAGCAAGAAGCCTCAACATGGCACCCAAGGAACTCGACGAACTCAAGCGATTGG
GAGACGATCTAGACGACGCGCCGTTTGTGTGTGGTGGGTCCGTGGATCCATTGCCGCGCGGCTCACATGCGCACGGCGTCACAGTGTGTTACCGAGACTC
TACGAACCAACTTCACGAGGTATCGTTTCCGCCTCAGGAGCTGAGTGATCTGGACCGGCTCGTGGTGGCCTGCGCGCCGGCGACGTTTGGTCGCGGCAAC
CAGGACGTGCTTGACCCCACGTGTCGCCAGGCTGTCAAGCTGGACCCGAGCCAGTTTACAACCTCGTTCAATCTCGCAGAGTTTCCAATTCTCGCTGAGG
TGCAGCGTGTCATCGGGGGTGGCACTGCCGGCGTGCGCGCGATCCTCCACAAGCTTAACGTGTACTCGACGGGCGGCTTCTTCAAGGTCCATCGCGACAC
GCCACGCAGCTCTCAGTGTCTTGGCACGATCGTTGTGTGCTTGCCGGCCCCATTCAGTGGCGGCGAGCTTGTCGTCAAGAGTGCGGACGGATCGTTTGCA
CACACTTTTGACTGGGGAGCAAGCACCGCCAACGGCAAGGTCCAGTGGTGCGCGTTCTATTCGGACTGCGAGCACGAAGTGTTACCCGTCCGTCGCGGCC
ACCGCGTGACGCTGACGTACGTGATCGAGCACCAGCCACTTCAGCATCCGATGCTGCTGGATGCTGCGCAGCCGTTTAGTGCACTTGGTGATCGACTGGA
GACACTGCTGAAGGACCCGTCGTTTGCGCCGCAAGGCACAAAGCTCGGCTTCGGCTTGCGTCATCAGTATATTGTAAGTGAGCGAACTGCTGGCAAAGCG
TCTACGGACCCAGAGCACGTGCTGGTGTCGGGTAATGCCGTGGCTGTCCCGCTGATGAAGGGAGCTGACCGTGTGCTCAAGGAGACGCTCGATCGTCTCG
GTCTCCAGTATGCATTCGTCCCCGTGTATGCTGGTGAGGGGTACAGGCCATCGGCAGCAGAAGAAGCTCGAGAAGCAACCAGTTATGCTGAAGATGAAGA
GTACTATGGCGAAACGTACGAAGGTACGCCTGTTCCGGCCCCCACAGAATGGCGTTTTCCTTTCCCCACTGAAGAAAACCCGCAAGGCGAATGGGGCGGC
GACGGCGAGAAGTGGCTCTACATCTCGGACTGGAACTCGTACTTGTCTCCAGTAGACGACCTCGAGTACTGTACGCCTACGGTCCTGAATTTCAGTCAAC
TGGCACTGCACAAGGCACGCGAGATTGTGTGGGTCGTGCGACCGGCCACCTTTCCGTACATAAAGACGAGCATCCAGTACGGCAATGAGCACACCCTGGG
GCACGATTACGCTGCGGCGTGTTTGCTCGTCTATATTTCCCCGAGCGAGAAGCGTGGGGTCAAGAAAGAAGCGTTGCCCTAACGCGTATTTGGTGATCAG
TCGCCGAGTGGTCTCGGTTTGTGCCCTTGCTGCCTACACGACTAGAGAGGTTTGGCCAGAGTAAGGGGGTGGTGGTTGCTTTATTTCTCGTGTTTCTCGT
TACTACAAATGGCAAAAATGCACATTTTTTGGACTATGAAGACAATTTATTTTCTGTCGAGTAGGGTATCAAGATGGCCCCGAAGAAGCCGCCGGGACCG
TGCACGTTGTGCTCGCCGACAAGTGCACAGTTTCGGCGGTCAAGCGAGGTCGTAAACTCTCCGGCACCGATCTTCGCTGACGGTATGTTCTTCTTCTTCC
GAGTGGAGTATATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCGGTCGCTGCGC
TGACGGTAAGTTGGGTCGAGTACGTCTTGCTCACCGCGACCGAATCTCGCCGTCGTACAGGCCTGCACGAGTTCGCCGCCCTCAGTACGCGGCGGGAACA
AAAGTTCGCAGAGGTGGCCCTGGTTGTTGTGATGACAGACACTCACGCTCTTGCACTGTCGAGACTGATTGGTCTGATGGATGAGAGAGAAGCGTTCTAA
TTGGCTGGCTCGCTCATACAGTTGGGCCCATCAATCAGTTCCACTTCAATGCGATCCTCAACAGATACCCGCATGACTGTACGCCTCTGTCACGCTCTTA
TCCGATGCAAGATCCTCAACTGACTGAGCCAAACTTATGCTGGCATGTGTGCAGGGTCGCAGCCGCGCATCTCAGCCCGAGCCAATCACACAAGGAGGGC
CCCAATATAGACACCCAGGCCTGGCCATCACTCCAGCTCACGCTCACAGTGAACTTCCTGGTTGTGCTTGGGCGCAAAGGCAGCCATTCTGAGAGGCGTC
CAAGGTCGAGCAAGTCAACCAAAACTCGAAGCGACAGCAAGAAGCAGCGGGCGCATCATCTGCCGAGGCTCTTGTTCGAGGACGAGCTCGTGACGTCCCC
GTCATTCGTTATCCCCATTTCAAATCGTTCATTCCCACAAGCGCGCGTCGTGAAGAAAGCAAGACCATGTCGGAACGCCTGCCGCCCGCGTTGGTCGACA
AGTACAAGATCGGCCGCGTCATCGGCGAAGGCAACTTCTCGGTCGTCAAAGAGTGCGTGCGCAAGTCGAACGGCGAGCGGT