Description :
From Genome Similarity Track
Location :
contig_6:148411- 166040
Transcript NameFunction/comments
g1785.t1hypothetical protein F442_14175
g1786.t1hypothetical protein L914_13793
g1787.t1conserved hypothetical protein
g1788.t1hypothetical protein PHMEG_0004847
g1789.t1hypothetical protein PHMEG_0004840
g1790.t1hypothetical protein
g1791.t1hypothetical protein

Sequence
17629 bases(100 bases per row)
TTGACAATGCCAGTGCGTGGGTGAACGCTGTGGCGTGGTCCCCCAAGGGCGACCATCTTGCGTTTGCCGGCCAGGGATCGTCAATTCACATCGTTCGCTT
TGGCGCGCCTGGCGAGTTCCCGACGATCCAGGTAGTAGAGGTTGCTGGGTCGAGCTGTGCTTGCTGTAATGTGCTGACGTTTGTTGTTGTTGCCATAGTC
GATCCGGTTCTCGCACCTGCCTCTGATGCGTATCATGTTCCTCTCGAACTCCGCGATCGTTGGTGTGGGTTACGACTTCAACCCGCTGCTGTTTTCTCAG
GATGCCAACAACTTCTGGTACGCATTAGCTGAAACAATTGCATCTTGCTTGATCGGGGTTAATCGTTGTTTGACAAATGCGCAGGTCGTTCTCTGAATTT
GTCGACAAGAAGCCTACGGAAAGCGCTGTGAAGCGGAACGCGGGCGGCTTCAACGCTGGTAAGTGCAAGTAGTATTGTATGGACCGAACACTGAATGTAT
CCATGTATTAACAAACGCCGTTTCTCAACCCCTCAGCTCGAAGCCTGTTCGAAAGCAAGGTGACGCGTGGTCAATCGTCTGATGCTACTCAGCATGATAA
GAATATGCTGTGGATGTACGTTTAGCAATGTCGTCGGACTCGCAGTCGTCATGGTACTAATATAACATTGTCCCCCGTTTACTCATCGCAGGAAACATGA
GAGCAACATCACATGCATCCAGCCGTACACGCGTTCTGCCTCGGGAAGTGTCTCGGAATTCTCCACTTCAGGTACGGCTCCAGTAAAACTTGGTCGAGCG
TTTGTTTGTGGTTACGTATCACTTATTTGACGTGCGCATGTGGCAACTGCTACTGTATTTCATAGCGCTTGACGGTCGTGTTGTCCTGTGGAAGCTCGGA
AGCCTGAATGTGGAAATGAGCAAGCTGCGTCTCTAAGAGGATACGTTTGCGTAGTAGCCCGACAAAGATAAAGCTCTTCACCATTGACGAAAACAGCAAT
TAAAATGCGCTAGCATCTACAGAAGGTGCAAGCAAAGCGAGCAAGACACAACAAGATCATGAAGGCAAGCATTTCAACTTGTCTGTCGATTGGTTGCTCC
TACCTACATACCCTCTTTCTCCCGTACTATAACAACGGCAACGACAGCTCTATTCGTACATCCGCTTGAGCCGTCTATAGTCTTGACGATATTGGTTCTC
AACCATAGATGCGTGACGGAAGTCCTTCCACTCAGGGAACTCCGTGAGTAGAACCTTCGGGTCGAACGAAAGCAGTAGCTGGATGCCCTGGCTAACGTCA
TTCAGCGTGCGCGCGAGATCGATGTGGTCTGGGTTCAAGTACGCTCGCTGCAGCTCAAGCAGCTCGTAGCTACTGCGTAGGAACAGGATCGAGTACTCGC
ACACCCGCTCAGTCTTCGCACGCAGCAGCAGGTCACACGAGTCTGCCACCAGTTTGTGGATGCGCATAAATACCAAGTGGTCGTGGGCCACGATCTCCAG
AGCGTCGGACAGTGTCTCGAGCGCCACGGACAGCGCAGAAGCAGCACTCTCCGGGTTCGTCTTAATAATCTCCTCTGCACCCACCAGCACCTTCTCCAGG
TCCTGCATGCCTGGCTTCACGCCATCACTGTCATCTGCCGCACTCGGCGGCGGAGGCAGCACACTGTCGCCTCGCCTGCAAAGCTGACAGCCGCACTTGA
ACCCGAACTGCTCCCACAGATTCTGCTGCCGGTTCTCGCGACTTTGCTCGCGGGGGTACAAGTACGAAATAGTGAGCTGCTCGCCCTTGGCGATGGGCCG
AGCCACTCTCACCTCGGACACGCCTCCTTCCGGTCCGGCGTCCTCCGGTGTGAACTTGACACAGTTCGGGTTGCAGTCGTGATTGAACATGGCGTTGTAC
AAGAACACACCACTATCGAACGCATTGCACTGCATGGCGAACACGTTCTGCAGCACCTGGTTGTGGGATAGCGGCAGCTCGCTGAAGTTCCGGCACAGCT
CGTCGATCTGCGGGCCGAACTTGTCTCTGCCTGCAGCCAGCAACTCCTCGGGCAGTTCACTCAGCTTCTCCGGGTACAAGTGGCCCAGATGCTCCATGAT
GTCGACGTAGTCCGGTCTCGACAGCACCGACTCCATCGTGGCTAGGAAGAACTCCGGGTCCGACGTGTCCACGTCACTCGGCCACGGGATATACACCTGC
TCCACGAGCACCTGGGTGCCCGGCACGAGGTCCTGCGTGGCCACATATCCGCGCGATCCTCCGACTCCGTCAAAGCTGGTCGCCAAGTCCACGGGCCCCA
CCGCCAGCGGCTTCACGTCGTCCCAAGGCTCGTACAGACTGCGCGCGACTTGGCTCGAGGCCTCTTCCTCCTGATCCACAGCTGCTGGGCGTGCAACAGG
CGCAGAGACGATGTGCACGACCTCGTGCGGCGTCACCATCGAAGCCGATGTCTCCTCATCGCTGCTGTCGTCGTCGAAGAGCCCGAACGCAGCCTGCACC
GACGCACTTGGCTTGCCACTCATGACGGTCTGGTTGGCCCGGAACTTGACTTGCAATGATTGTCGTGTTACGTACAAACATCAATCGTATCAGAATGATT
GCATTGTTATGTATCACACACCATGATTGCACCTCCATACAAACACCAAGTGAATCTGGGGCATACCGACTCCCTGGCTTTTGCGAGAAATGGCCGAGCA
CCTGGCTTCTCAGCACGAGAATGATAGCCTCCCAGTGCGCCCAGGGCTCCCCCTTGGGCGCCGCATGCGGTTGACGCTGGGACAGAAGCGCGAAGTGGTG
GACCTGGCGGCCAGCAAGAAGTTCACGCACCGCGAGCTGGCCGAGAAGTTCCGCGTGGGGCGCACGACCATCACCAATATCTGCCGACAGGAAGAACTGA
TTCGATCCGAGACGGACTCAGCCGACGCTGCCAAGAAGAAGCGCAAGACCACAAAGTGCACGTACGACCTGCGTGTGCTGGACGAGAGTCTACACAAATG
GCGCATGGAGGTGAAGGTGAGCAGTCCTGACACGAAGCTCACGGGCACAGTACTGCAGCACAAGGCCATGGAGCTGGCCTGTAAGATGGCTGACGACCCG
TACGCGGCGCTTCCCGACAAGGTCAAGCAGGCGCTGCACAAGTTTACGGGCTCGAACGGCTGGCTGGACGGGTACCGCACAAGGTTCGGGTCTTTCAGCA
GCAAGCAGCTGCCTGGAGGAGGCGACCAGAGCGTCATCAAGAGCGTGGACATCCAGACGAGGCTCAGAGAACTGCACCACAGCTTCATGAACGTGCAGCT
CGAGGACATTTGGACGGCCAGCGAGTTCGCAGTCATGTACAAGCCCCCGCGCCCGTGTCTGACGGCAGTGCAACAGGGAGTAACAATGGCAGGTACACGG
TTTCGCTCTTTGTCAGCGCGGCTGGAGAGAAGTTTGATATGCAGGTTATTGGCATGGATCGCAATCCACTACTGCTGGAGGGAATCGACACCAAGGAGAC
GTACAAGATCCAGTATGGCTACTCCAAGACGGGTTGGCAGGTCGCGCAGACGACAGTGAGCATGCTCAAATCGCTGAATGCTCTCGCAAGGGAACGCAAA
CGCACGTTCCGCGTGGTTTTGGACTCGGCGGTGCCCCACGTGAAGGCCGCTATGATTCTGGACTCACAGGGCGACCAACGAACGTTTTTCGTGTACGACC
ACCTCCAAATCTACTTCTTGCCACCGAACTTCAAGGCCCCGCGTTTCCACCCGTGCCACCTTGGCGTGATTCAAGCGTTCAAGGCGAGGTTCCGCAGTGA
AATGCTCGAGACGCTCTTCAGTAATTATCGACAGAGCGTGATCAGCCAGGACCCGCGCGGATTCCACCCGCAGCGTCACTTGCATACCAGAAACGTGTTT
CACTGGTTCAATGTGGCTCTGTGTAGCCTGGATAAACAGCTCATCCAGACGTGCTGGGTCCAAAGCGGTCTGCTGCCCACTCAGGCCATTGCCTCCCTCA
ACTTACGCGCCATATTGAGCAATACCTCGCCCATGAGCATGACCCCCAATACCTCAACTGGTAGTGGCAGTGACAGTGGCAACGGAGGTGCAAATTCCGA
TGTCAATGGCATGACCCCAAATGGAGCGAGTGGAGCTGGCTCTACAGTCGTAGCACACGCTACACAAGGAGGCCTGCTGTCGCCCGCGGTACTCTATCGC
GATTTACAGTTGCAACTGACGAATATCGCCCAGCTCGCTCCGGACTTCTTGCGCTGGATTGGCGTGAGCGATCCGAGCAATGCGCAGGCATTTGTGGAGC
TGGAAGGCAATGCTTCCGTAACGGACCCCGGCATCGATGAAGTGCAGATCATCCGCGGAGTGCTTCAAAAACATGGCTACCTGTCCACAAAAAAACTGGA
TGATGAAAGTCATGCCGAGGGTCCGTACGAAACCTTTGACGACGTGGCTGATGAGCCCTGCCCAAGGCATGATGAAGTTGTGGCGTCCATTGAGATCCTC
AAGAAGTACCTGAGGCTGTCACGGGACGCAATCCCAGACCGTGTCGACGCTGTAGTGCAGCTGAACCAAGTCAAAAAGGCGATTAATGCTGCTGCCTTTC
GCGACGCCGCCATCCGGGAGGTATGAGTGAAACCCACTTGACGGAGTGAAATGTGCGGTACTGTTTTATTCTACCTGGCATCATGCTCATCGTTCTCATT
GTATTGTCACTGTTGTCGGCTCTATCTTACATATGCATGGCTCTCGAATATTGGGTGCCCTAGCTAGTACACAGTCCGGATTCTGTAGTTGGGAGGCATT
GCCGCCATCACGGTGTTATCGTCTAGCCGTTGGTTCGTCTGGGTTGGCAGCGGCGACGACATCCGAGCAGGTGGGGTTGACTGAGGCAAGAGATCATCGT
CAAGCGGCAGGATAGTACGTTCCGCAATGGCCTGCTGCTCAATGCGACGTTGGCGCCGTGCGTATGCTACGAGTGTGCGCAACGCACTCACTAACCAGTC
GCGGTGGCTTGAGCTCTGGGTCTCAAGATCCAGTGTACGATCCCGGAAAACAACCGAGAAAGAGCACGCCTCGAGCACGCTGTTGGACGGGTACTTGCGG
AACACAGCCGTCTGTCTACCGTCCAGCACCTGCAGCACTTCTGCCAAGTCAACCGCTCCACTGAGCCCGCCTCTCTTGTGCTGCCACTGCAGAGTTCCGC
AACAGTTGCAATGGAGTCGGGTAGCATGAGCACCGCCACGACGCCCATACTTGAGTAGAGGGAAGAACATGTTGATTGCCTGCACGAGATACGACCGGTG
CTTGCCGCCAAAGCGGAAGGCCAGCTCCACGATCTTCCACCGCGCACCTTCGATGGTCTCGAGCTCTTCGTCTGTGAACAAATACGTTTTGCGCTTCTTG
CGAAGATGCAGCGTCTCCAGCACGCGTGGGCCGATCCTAGAGAACGCACTCTTCTTGTGTTTCTTCGCAGGGTGCACTTCTTGTGCAGGGTTAACTAGCG
GCGGTGTCGGCATCGGAGACCCAACGAGCGGAGACAACATGTCAGTTGGCTCCAGGTCGTACGCATTCGGGCACGACCCAGCTCTCCTCCGCATCGGTGC
AGGCTTGGACTTGCGACGGACTCCATGAGACTGGGCCATGGGTGTGCTCAACTGGTCCGAGTCATCCTTCAGCTGGATCACCAGCCGCCGCACGCTTGAG
GTAAGTTGATCCTGCGCTGACAGTGCAGCTTGCTCGGCCGCGCAACTGAGAAGCCGAGTGCGTCGGCGCTGCAACAACCGGTGCTCGGCCGGGCTCAACT
GTACCAGCTCGTGCTCGACCTGAGACGTCGCCTCTTCTACCTCGCTACTGGATCTTCCTTCGTCGTGCTCGGCGTTGTTGTCATCGAGGTCGAGCTCCTC
CACGTCGTGGATCTCGTCAACGTCCTCGTCGTAGTCCTCGTCCTCATCTTGGTTGGACACCGCAGCCGTCGCGCTAGCTACCGGCTCACCCGACTCGCTC
ATCAGACTCTCGCTCTTGATCCTGTTCACGAGCGTGCCGCACACTCGTCGACATGTTCAGCAGGTCAAAGTCCAGCAATTCCTCCTCATCACCAAAGGCT
CCACTGTCTTGTTCTGCACCCGCGTCCGCTCCAAGTGCACCCGCCGTTCCTCTTCCTCGAGGTCCTCCTGCTCATTATTGCCCCTTTCGTCCGCCTCCTC
TTCGTCCGCCTCCTCCTTCTCCTCCTGTTCATCCGGTAGTAGCGCCAGCAGCGGTGCAAAGCTCGCGTGCATGACTCCGAAAGTGTCAATCTGCGTCTCG
AGCGCCGCTCTCCTCGCCAGCTCCTCTTGACTCAACGGCCGAGCCAACGCCGCCGCCACTAGCGGCCGCGCCGGATAAAACTGGAACCGCTGGCCGTTGC
CACTGCTGCTGCTGCTGTTACTGGTGCTCGGGTCCCACATGGTCATGGTCGAGTGCGTGGGCGTGGCGCCGACGCTGCTGCGCCGCCCGTGCCGAGCCGC
CGGAACCGTCGCGACGTCGGCCGCGGTCTGTTCCTTGTCCTCATTGCTGCTGCTGCTGCCGCGCGCCTCCTCCGGGTCCGCCTGGAACAGACTTCCGCGC
CGCACGATAGCCGACAGTTTGCCTAGCAGCACGACGCTGGACGAGCGCTCGCGGCGTCCGCCCGACCACGGCTGCATCGAAGAGGGAGAATCCGGGAGAG
TGGGAGCAGCCTCCACCCCAACGCGAAATGTGGGCCGAGGAAGAGGGAGGAGGAATGAGAAAACCGCCGTGCAGTAACAGGCTGGCACGAGAATGGCTGC
AACTGGAAGCCTGCAAGATAGATAACTGCACTTGTGACCGAGTGGGCGTTTGCCAAGTCAAGGAGCCGTTGCCGAGAGTAGGTGTCTTCAATGTGCAATG
GCTGTAGCCATGTCCGTTTTTATCAACTCTGCAAAGTGCTGTTCCGAGCCAGCCGCTGTGTTCGTCCACAGAAGGACGGTATCAACTCGGCAGAGGGGCA
ACCGAGTCGCAGCTTGGCAGGATGAAAGCCGTTACCGGACTCCACTGGCACCTGGCGAGCGCTGCTGGCCAGAAAGCACCAAGAAGACGGCGGTCCTCGC
CAGAAGTCTGGTCTCTCGCCGAGTCTCACGGGCTCCGATGCCCTCTATCTCCACTAGCCAGCCCTGAACTCTACTGCCCACTCCTTTCAGCCGCAATATG
CTTGCGGTTTGCTGGACTCCCCAAGCCGCTGGTCTTGCCTCATCGCTGACGTACTTGTGGTACCACTTTCCGGGTACGGTCTCCGTAACGGCCAATAGTC
AACATGGTGAGTGGTGGCAAGACGCCTCGTCGCGGCCCCACGCAGCGCCGTGGCCGTCTCCAGGGAGCAGGCGCGCTGCTGCAGAGCAGTCCCGACACTG
CGTACCCGTCCTCCCGTTTGCTCGTGTGGCACTCGCGCTTCACACACGGTGCGTCTCGCCACGAGGCCGCCGTGAGCGGCCACGCTTTCAACCAGCAGCT
CGAAGTGTATCTGCCTTCCAAGGCCGGGAAGGCCACGGCGCAGTCACTGCAATGGGAGACGGGCTTCTACTACGAGATTAAGGCGTCGGTCGGCATGTTC
CTGTCACCGGCCTTTATTAAGGAGTACCTGCAGGACGGTGGCTCCGTGTTCATGGTGGCCAAGAACGTGGCGGTGGACGCCGCGCAGTCGGCGATGCTGC
TGCCTTCCGGCCAGTTGCTACTACTCGTGGATGCAGACACGTACCAGCAATTGGGCATCGTGGGTGAGAAATATGGTAGAGCGCTGCCTGCCACGAGCAG
GACGAGGCGGGGGCAGAAGTACTCATCACGCTCGATTTGACGTCGTCGGCGTTTGCAGAGGAGGGGGAGAATGCGTTTAGAGATCGAGTGAGAGAGTGTT
TGAGCAGCAGACTGGAGGACCTCGAGATGCTGCTGTGTGCTTACAACGCTCGCGGATCAGCACGTACGATCTTGTTTGGAGACGATGATACGGTGCCTCG
AAAGCGCGTCGAGCTTGATGGACAAACGACGACGTTCAACGAGGTGTTTCTGCCCAAGTTCGACGCGTTTTATGCTGTGTTGAAGAAGAAGGGCGAGCGT
GAGGATGGGGACAATGATAAGCTGCGGACGTCGCTGCAGGAGGCATACGACTGGCTGGGCCTTGTGGCCTGCCGGCTCACTGACTTGCTGGAGAGACAGA
AGCTGGAAGAGTACGTGTCAACCTTCTCGGGCATCCCTGATTCGTTCGAGTGCGAGCCGGATAGCGAGATCACGACTGTGCGGTGGCGTGGTCTGGTGGC
CGCTCCATTTTGCTCGACTGTTGTCGAGAAGGTGCAGCGTGCTGTGAAGAACAGGGAGGTGCCATGGGGTGCAGTCACGGTTTGGGGGTTCCCGGACGTC
TTCGTGTCGTGGGTGCAGCCTGTCAAGACTGGCAAAGGCAGTACACGAAAGAGTGAGTCGCAGCGACGAGAGCATGGCTACCTCGGAAATGGTAGCAACA
ACTACACCCTGCTCATGCTTCCAAACGACGAGTACTTCATGCTGCAGGCACTCGGTCCACACGATGCCACCGTGTAGACGACCGAGTAAGTCGAGTATCT
AGTACAGCATGGATAGCACACAGGGTTACAATAGAATAGAACGTTGCATCACGGTCGATCTTGGCTTTATCCGCAACTATCCGAGTAGCTAGTTAGCGAG
GACGTTCTCGACGAACGCCGCAACAGTGGACGAGTCCGACCCAGCTTCGGCTAGCGCTAGCGCCACCTTGATGTGCTTGCGAGCCGGCTTCACGTTGTTC
TTCTTGCCGTGGATAAGTGCAAGCCGCAAATTCGCCAAGAAGCAAGTAGCAGTATCACTGTTGCTGCTTAAGGCGGTGGTCGTGCTGCTCACATCGTCAT
CAGCATCTGCCGAGGTGATAAACTTGGTCGCCGTCAATGAAGCAACGAGCTTCCACACGTTGATTGCAGCGTCCAAGGATTGCTGTTCTTCATAAAACCC
TCCGAGCTCAATCAGGATTGGAACCAATCGGCTCGAAGCAGCAGCAGCAGTATCGGCAGAGACGGCAGCAACAACGTCCACGTACTTCTGAACGGCCTTT
GCCGGGTTTGAGATCGATAGCAGACGTGCTTCCAGCAGGTCAGTGTCCACCGAGTCTGTCAGAGCGCCCCTCTTCTTGCTTTCTTTAACTCGAGTCAGTC
CTTCGATTGAAAACGATGTTGCTTGATCGTGTTCTCCGAGTTTGGCATAGCAGTAGCTCGTCAGGAGCTCCAACTGAGCTGCATCATAGTCTCGCCCACT
TGCGGCAATAGCAAGTGACAATCCGGTCTGCAGCAAGCGCAGCAGATGACGAAGAACGTCATGGTGCGTTTCTCGCTTCGTTTCCAGACCAATGCGCTTG
AGGATGCTTGTGCCAGCCAGAACGTATGCCTGTGAATTCCACGGCTGGGCGCGAATTAACTTTTGTGCGTCCAAACACAGCCCCTTTACCCCGGATGGGC
CAGCCTTGAACAATCCCACCAACGAGTCCAAGAAGTTGCGATCCACCGTGTCCTTGCCAGGGGAAGGCACATTTCTGGCAGTCGAACGCAAATACTCTCC
CAGGCAACTCGACACTTGAAGGTTTTGCGAGTCGATCGTCGCTAGAGCCAGACGCATCCATAGCGAACTTGAATTCGCTCCGTCATTGGTTTGCGACAGC
GCTTGAAGGCGCGTCAGGTAAGCATCTTCAGCGCCCACAAAGCGTTCGTGGAGCTCAACCAAGTGCAGGTTCAGATAATCGCGCGTTGTGAGCGTTGAAT
CAGCTTGGTCAACTGAGGACAAAAGACGCTCCTTACACACTGCTGCAAGACCCACTGCCTTGGAGCCAAACTTGCTCATGAGCAAGCTCGCCATCGATAG
ACCCACAAGCGCAACGACATTACTCTCAGCGGACTGGGCTTCATCTCGTGGAATCAACGCGTGAAGCAAATCCAGCGCCTCGCCTCCCTTTGATTGACGG
TATAGTAGCTGCGCTTGCACGATACCCTGAAGTGCTGAGGACCCACTCGTCGCGGCAATCTTTTGCAAAAGCGCTGAATCGTCAATTCCATCGCAAGATT
TATCGGAGAGCTGGCCAAGCTCAGTCACTAGCGTATTCCATTCAAGGCCTTCTTGGTCACGAGCAGACGAAGCCGCATGGGTGTAGGACGCCAAAGCCTC
GGTGTACAGTCCGAGGCGGTGCTGAGCAACACCTAGAGCGTGCCAAGCGCGCGCATTGAACGGGTCTCGTTCTAAATACTTCTTCAGGTAAAACATCACC
TGCTCGCTATCATGCTCTGGAGCCTCCGTTATCGACTCACCGACACTAGCTCCATAGTCCAACAATGCCGTGCTTAAGCCAAGCAGAGCATCCAGATCCA
ACCCGACTTGCAGTGCACAGTTGAATGCTTCGATCGCTTTTCTCTGCTGAACCGTTGAGCTAGCTTGGCGTCGAGCCAGCATCGCATACCCATTCCACAT
AGATGGGTTGCTTGGGTTCACGCTCTGCAGCTGCAGAAACGACTTCTGCGCCAACGACGCCGCTGATGGCACGGCATCAGCTTGGCTGAGGTAAAACATG
CCCAAATTGGCCCATGTGGCATCGCTATGCTGCTGCGGTTTGGACTGCTCGTGCCCAGGCAAACTGCTTCACCAGCAGACTGTCAGACACAAGCGCCAAT
CCATTCCAGGCCAGCGAGCACGAAGGATCCTCCTGAAGGGCCAACTTGAAATTCGTTGACGCTTTCGCCTTTAGCTTCGAGAGTGTAGCATCTGCGTCAC
TGTTGGCAAGACCCTTTTCGATAGAGAAAGCTGAACTGGGGATGCCGCGCACGTTGCTGAGAGCCTGAGCTTCGTACCAATAGCTTAGACCGATATCATA
AAATCGCTCTGCGGCGACAGCGTCAGGACCCCCACTGTCTTTTTTTCGCCCCTTTCAGCTAGTAAAGCAGCAGCTTCGTAAGCCTTCCTCCCAGCGCTGA
TGAAATCAACCCAGCTTGAGCCTTCGCTTGAAAAGTTGTCTGGCGACAAGTAGAAAGCGAAGCAGTGAATATCACCGATTAGCTTGCACGCTTCCACAGA
CCCAGAGAGGGCTGACGTGGACGGAAGTCCCTTCATCATTCGGGACGCCTCCTTCAGATTCGCAGCAGCATTGCCATATAATCCCTCAGCACATAAGTAT
TTTGCCTGTTGGAAAAGCAGGTCGGCATAGATCATGGATGCGACAGTCACGTCTGGCTTGCCATCGGATAATTCACCAGTGACAACCGGTTTGATTCTAT
CCAACGCATCGTCGAAAAGCAGCAATGAGCCTTCAATCCGAGCCAGCTCACAACGAACGCACCAGTTTTCCTCACCCAGCTCGATGGCTTTCAAATAAGA
CCTCTGCGCGGAAACGTGCTTGTCGAAGTTCTGGTAGATATGTGCCAGAATAACCCAATAACGGGCATTCATAGGGTTATTACGCAGCACGAGATGCATT
TTTCCCACTGCCAATTCGTCGTTTTGTTCCACCAGGTGCTGAGCCAGTCTCAGGAGCGCCCATGTCGGAGCAGTTTCTTGGTCCTCAGTCACTCGTTCCC
ATAGTTCCACGTTCGCGCCATACTTTCCCTGTAGATCGTACAGGCTGCTTAGAGCCATTCCTGCCAACTCATCGGTGGGAGAAAGCGAAAGTGCCTTCAA
GAAACACTTTTCGGCACGCAAAATATCCTTTGCGACTTCTTGGTACCATTTACCCAGCCATGAGAAGATCTCCGCGTCGGATGGCGTCAGCTTCGCGGCT
TGTAGTAGATGGGCAAAGCACCCTGGTTTTGCACTTTGATGAGAACCGCCTAGGTGCCAGTACACAACTGCTAATCGCTTCAGCGTTCGCCCCTTAGCGA
AAACATCAGTGGCTGGAATCTTGCTCGCATTTGCCTCTAGCAGCGCTTGGGCTTGTTGGAAGTCGCCAAGTTGGAATTGAATCCACCCACGGGTGCACAG
CACAGCAGCACACACGCTTTCGTCCCCCACTTCAGACAAAGAAACGGAGTCAATGACTTCGAGAGCCTCCTTTGACTGCGCCTTGGTAGTCAATAGCTCT
GCCGCTGCGATGGCCGCTTTTACCATGAGAAGAAGGTCGTCACTTCCCATGACTCCGCGGTAGTTCTCTAACGCTCTATCCACGTCACCCGAGTACTCGC
ACGCCGTTGCCGCCATGAACAGCACCTTGACTTCCGAATACCTGTACCATTTCAAATAGACCAGAGTCATTGTACGTCAAAGGCAACAATGGTAGGCGTT
GATAACTTACAGAGATGGAAGCGGGTCTTCACACCCAAGCAATTTCGCCTTGTCAGTCACAACCTTTTTGGCCAAGGACAGACGATTCAAGCAACCCTCT
ACATCGCGGGCTGCAAGTGCCAGTGATGCCAACTCGACTTGAGCACGAATGCAAAGAGAGCTTTCTTGAAAAGAAGAGGAGGAGTAACCAGCGAGGGCTT
CCACAAAGATCTCTCGGGCCTAGTAATCCAAACGCATGTCAGAACTTACTGTTAACAGCAATGCCGATAGAGTCAACCACTTGCCTGGTTACTCTTTCCG
AGGCGCAAGTACTCCACCGCTTGAAACACAAGAGCCATAGGACTCCTGGAATGGCTTGCAAATAGCCCAGCCGCGACTTCCCTCGCCTTATCCAAAGTAA
TAGCTACCCGTTTTCAAACACCATCAGCAACAATGCATCAGCTCCGCCAACAATTAGCAAAGTCGACAGACAATAGTACGCATGGAATACGTACGACTAT
CCTGGTCTTCACTGCGGAGTAATAGGAACTCTGCCGGAATCTTGGAACCAGGAAACCACTCGATGATTGTCGTCGCCAATGCATCGACCGTCTTGAGGAG
CGTGGGCTTCTTTTTGGAAGCCTTCAGTGCATCCAGGTGAAAGCGCATAAAGAACGCGATTGCGGCATCCATTCGTGGACGGAGCGCATCAATCTCTTCA
TTCTGAGCTGTCCAATCAGTACGAGATGCAACGGCGAACACGTGACGAGAGATTTCTGGCATGGAGTAGCTGCCAGAGCAGTCCGATAAGCTGAACCCAG
GACGCTGTATCAAGAACCTTCAATATCCACGCCAGACAGCATAGCAACAACAACAAAATACATACCTGCAGCAAATCCACCAAATCCAGCCAGATATTCA
GCGGGGCCGGTAATTCTTCGTTCGCAGTTTTCTCGAGCGAAAGCTGTCCAACATCTCCATCCAGTCCCCCCACAAGGGAGTACCACGAGTCAAAGGTCTA
CATCAAAGCAAAAAAATGAGTATACACTATCTTATTAACGTAGCCATAAAGCTACTCCACCTTCGGGAGCATCTTCAACTCCATTGCAGTAGCCGCCACC
TCCGCTACCCACTTCTGGCACCTCTTGATCTTCTTGCCCCTGCAAATACAACAGGTATCAGTCTACAAAGGTCCACCCAGGTCTCCCTCAGTTTGCAGTA
CCTCAAATTGATGTCCACGAGCTTCTCCAGTGGCTCCAACTTGCTCTTCACATCCGTTTTGGCCTCGAAAAGGTCCACAAGGTACTGCAAAAACCGCAGC
AGAGAATCAGTCTCAGTCTGCAACCTAAAGTAACCCTCACCACGCTCTGCACCTTCCAGGGCGCCGGCATCTCGGGCTTGATATCTGCCGCTCGGCGATA
CGCGTCCTCGCAGTCCTCCCACTGGCAGCAAAGTATGGTTAGTATGGGTTACACATTGGGGTACAGTATCCTGCAGACGCACCTCTTGCAGGTGGAAGCT
GGCGAGCCCACACACATGAAGGCCTGGAAGTTGTTGGGGTCAAATTGCGTCACGCGGCGGCCTGCGTCCTGCGCCTCCTGGTAGCGCTCGGCCTTGAGGA
AGGCCGCGGCGTCCACTAGCATCTGCCGGAGCATGCTCGCCGACATGATGCTTCAATGGTTATGCTGGTTTTGAGGTAACCTACATTCTGAGGATGGTTA
CGAGTAACCTTCGTATTTTAGGTAATCTTACAAACACTCATCCGCCAATTCACCCAGAACCATGTGGAAGACCGGAGTACGGGTTGTGACGCCTCTGCGG
CGCTCGCTCACGTCTCCGCTGCGCGGGCAACTACCGAGTGGGCGTCCGCGGTCACTGCAGGTGCTGTACGTGGCGCGCCCCTTCTCCACGTCCTCGCCGC
CCCCAAGTACGTGACTTTTATTGCGTAGATTGAAGTGCCCAATCTAATGCGGAATTGGGTCTTTTCACTCGCTCTGGGTTTTATAGCCACGCAGAATGTG
CAAATGGCGACGGCGGCACTGGTTGCAGCCGGTGTGGGCTATCTGTGGGTGACGAATGACCGCCAAAGCGAGCAGCAGCGCGAGCTGGAGATCCAGAAGG
AGCGCAAGCTCAGCAACCGTCTGGCGGCCGAGCTCGTGGCGGCCGAGGCCAGCCAGAACAAACTGGACTGGAAGGGTACGCTGGAGCGTGTCGTACCAGC
TATCGTGTCGCTCAAGCTCAATTCACCTAAGGTGAATGATTTTTTTTTATTGTGCTGACATCATCAATGTTGACTGGGTGATTGCGTCTGGGTTGTTTTA
GTTCTTCGACACGGAGTCGCCGGGCAACGGGTCGGCCACAGGCTTCGTCGTGGATGCCGAGAAAGGGATTATTCTGACAAATCGTCACGTCGTGGGACCG
GGGCCCATTGTACGCGAAGATGTTTTTGGGTAAAAGGGGAATAATTGTTGATGAGATGTTTTTGTGGGTTTTATTAGGACGCCGAAGCGGTTTTCCAGAA
CAACGAGGAAGTGCGCGTGATCCCCATCTACCGTGATCCCGTGCATGACTTTGGCTTCTTCCAGTTCGATCCGGCGGTAATTTTGCTTTCGGTTGAAAGG
GTGATGTTGGAGATATTTAAGTATTTTTCTTATGGCGATCAACAGGATGTGAAGCACATGTCGGTGCCGTCGCTGCATCTGCATCCGGACAAGGCCACTG
TTGGAACGGATATTCGTGTGGTGGGAAACGACGCAGCCGAAAAGCTTGCCATTGCTAGTGGCACGCTGGCGCGTCTTGATCGTGACGCTCCCAACTACGG
CTTCAACAACTACAACGACTTCAACACGTTTTACTACCAAGCTTCGTCAGGTACGGTTTCAAGGAAGGTTTTGTATCGCTCCGCTTGGGCTAGTTGCTTA
TCATTGCTTCTGGGTGGCAATGCTGCTATTGCAGGAACGACGGGGGGATCGTCGGGCTCTCCTGTGCTCAACCACGATGGCGATGCTATTGCTCTTAATG
CTGGCGGCAAAATTGGCACGTCTGCTTCGTTCTACCTACCTCTTGATCGTGTAAAGAGAGCGTTTGATTTAGTTCGAGAAGGTAAGGACGTGCCTCGCGG
CACAATCCAAACAATTTTCAACTACAAGCCTTTCGACGAGGTGCGCCGACTTGGCGTAGACCCCGCCACGGAACGGCTCGTTCGCTCGACTTTTCCGTTG
GAGACAGGCATGCTGACAGTGGCAGAAACTATCCCGGGTGGCCCCTCAAACAAGAAGCTGCAGCCTGGCGATTTTTGGTTCGCGTCAATGGAGAGCTGAT
TACACGATTTGTGCCGCTGGAGGCTATTCTCGACGACAATGTTGGCGATGAGGTAAATGTGCCTATTGAGTTCTTGCTACGCTTTTCCCCTGCAACGTAA
CATTGCTGACACGTGGATGGCAACATGTTTCGTAGATCGAGCTTCAGATTGAGCGATCTGGAGAACTGGTGACGCACAAGATGCAGGTGCAAGACCTGCA
CGCTGTCACCCCATCCCGCTTTATCGAAATCGGTGGGCAGTAATCAACCCACTGTCATACCAACAAGCTCGGAATCATGCCATGAGCCCTGGAGCTCCGT
ATGTTGCAGATCCGGGCTACTTCCTGCAGCGCTCACGGATTGGTCGTGGTGCAATTATCCACTCGGTGAATGGCGTGAAGACACCTGACCTAGAGACGCT
TAAAAACTACCTAAAGCAGTGCAAGGACCGGGAACGCGTCGTAGTGAAATTCTCAAAACTGACGGACAAATCGGAGAAAGTCGAGGTCGTGCATGTAGAC
CGCAGGTGGTTCCCATTCTGCGAGTACGTGCGCGACGACAAGCTTGGTACATGGCATTGCGAGCGCTTTGCGCCACCCAGCAACGCGAATGATGATAAGA
CGGACAACTCAAGTGCCGATAAGCCAGTCGGCTCGACGACAACGCTGCCGGGCAAGAACCCAGTTGAGAACAAGCTAGCGCGATCGTTGGTAACAGTTGA
CTTTGACCGACCGTTCAGCGTGAACAGTTTGTCAACGTCGAACTACCGCGGTACAGGACTTGTTATCGACGCTGAGAAGGGACTTGTGGTGGTGGATCGC
AACACTGTGACAGACTCGATGGGCGATGCTATGGTGACTTTCGCCAGCACCATCATCGTCCCAGCCCACGTCGTGTTTGTCCATCCGGTACATAACTTCG
CCATCGTACAATACGACCCGAAGCTCATTGGGTCGACACCCATTGAAAGCTGTCAAGTGGCATCTACGCCATTGGTGCCGTCTGATCCAGTGTGGCTCGT
TGGTCTTATGAGCAGCGTGGGGCGTAGTGGCCATTCCGACCTTGTTTCCCGCGAGACTATTGTGTCTGGCGTTAAGTGGATTGGCTTGCCCATGCCGAAC
CCACCGCGCTACCAAGAACACAACCTGGAAATGGTTTCGTTGCAGGACGTCGTTGGCACCGAAGGTGGCGTTGTATGCAGTGATGAGGGTGAAGTGAGTG
CCTTTTGGGCTTCTTTCTCGTTCCAACAGCAACGCCGTAGCTCGAAGGTGGAGAGTCAATTCAATCGCGGCATTCCGATGGATTTGATCATGGAAAGCGC
GGCGCCGCTTATGCGTGGGTGACGCCAAAAATTTACGACCTCGGTGTTGATTTTGAGCACTTGAGCCTGGCCAAGGCTCGAGAGCTTGGACTTGGCCAAG
CACTAGCCGAGATTTTGGAAAAGGATGCGCCTGATCGCCGAACCATCTTGAGCGTAGCACGACGGTGGGGTGGAACCGAGGCACAGGATGTGCTCAAAAA
CGGCGACATCTTGGTTGCTGTGGATGGCAAAATCGTGACAAGTTTTCGCGAGGTTGAGCGCTGCACACAGAAACCGGAGGTGCAGCTCACGATCGTGCGC
GATGGCCGCGAGATGCAACTGGACGTAAGGACCCTTTTCATGGAGCGCACGGAGATCAACCGCATCGTGTTCTGGCAGGGTTTACTCCTACAAGCGCCAC
CGCTATCCGTGTCAGCGCACGCAGTATCTCGTTGGACGACGGTATCTACGTGTCCTGCCGATACTCGGGCTCACCGGCTGCGCGCTACGGCCCGCCGCCC
ACAAGTCGTATCAAGGAGATCGATGGTATCAAAATCACGAGCATTGACGACTTCTTGCGCGTCGTCACTGCGAAGTCTGATAACGATTCGGTGCGTATCA
AGTACACGGACCTCAGCGGCAAGGATCGTTTAAGTACGCTTAAGCTCGAGCCAAAGTACTGGCTCACCAGCGAGCTGGTGCACGAGGGAGGTGAATGGCG
TCGTGTCCAGCACTGAAATGGCTATATCT