Description :
From Genome Similarity Track
Location :
scaffold_54:148383- 153353
Transcript NameFunction/comments
Plaha_PHALS_02190replication factor c subunit 4
Plaha_PHALS_02191Vesicle coat complex COPII%2C subunit SEC13
Plaha_PHALS_02192BRCT domain
Plaha_PHALS_02193ras-like gtp-binding protein ypt1
Plaha_PHALS_02194hypothetical protein

Sequence
4970 bases(100 bases per row)
GATCATGTTCAGCTCTCCAGTGACGTCCAAGACAAATGTAATGGCGCCAGTACTGCCCTGGGTAGAAAAATAGTACGTACTCCGCTGTCATGAACAGTTC
ATAATCTGTGCACTCATCTGCGTGCTATTTCTACATGAAGTCGCCCCAAAAACGTGAACGAGATCGCTCATCAGGAGCATGTTGTTGCCACGCTTAAAAC
CTCGATATCTAATGGACAGCTGCCCCACTTGCTATTTTACGGACCTCCGGGTACGGGTAAGACGTCCACCATTGTAGCGGTAGGTCGGCAGCTTTTTGGA
CCAGACTTCCGCAAAAATGGCCGATTTTTGGAACTCAACGCATCGGATGATCGAGGCATCAAGGTGGTCCGCGAGAAAGTGAAGAGTTTTGCCCAAGGTG
CAATAAGTAGCATTAGTGGTCTACCGCCCTTTAAGATCATTGTTCTTGATGAGGCCGATTCTATGACCGGTGACGCCCAGTCAGCGTTGCGGCGCATGAT
GGAAAACTACTCTAAAGTCACTCGGTTTTGCCTTATCTGTAATTATGTCAGCCGTATTATTGAGCCCGTGGCCTCACGATGCGCCAAATTTCGCTTTGCA
CCACTTGAAAGGGTCTCTATGGCGTCTCGTATGCGCTTTATCGCATCGGAAGAGCATGTTAATGTGTCAGACTCGGTTTTGGATTTGCTTCTCGAGTGTT
CAAACGGAGATTTGCGTAAAGCAATTAACTACTTGCAAAGTGCCAAGCAGCTTTGCGCCGATGAGGACCTTTCAAATGATGATGTTATTGCAGTGGCAGG
TCTTGCTCCTCTAGAGCTACTGCAGCAATTTTGGGCTTCGGTGGCTTCTAACAGCTttgagaagatgaagacagaCATTGAGAGCATATTACTGGCTGGA
TACCCTGTGCTCACAATATTGCGGCAACTAAATGATGACGTGCTCTCACTAGATAAGCTGAATGACGTACAAAAGGCCAAAATTTGTCTTCGCATTGCTG
AGACTGATAAAAAGCTGGTTGATGGCGCCAGTGAGCATTTCCAGCTGCTCGACGTCGCATCCTATGCTATGCGTGTATATCACACATCGTAGATCTAGGA
AAAATCGAGCAATGACTAGGATAGAGACACAACGTTTCATAATTGTTTCGATTGCTAGGTATTAATCCATTACCTGGCACGCAATAGTGACCGATAAATC
TACATTTGGTTGCTTGCAATTATAGCTGCACCTTGATCAGTTACAGAAGATATGCGCTTCCATTCATGATTGCTTTGTTGCTTCCATAAAGTTATCTCAT
CATCACCAGCGGCAACACTGAGGACAGCGCCCGTGAGAGACCAGCCTATTCGATAAACGGGTGCAAAAAATGTATGTACTACATGGGAGGCCCAATCGCC
ATCGGCCTCATCTTGAGTCCAAACACGCACCGTATGATCATCCGACCCCGATGCAATCACGTTTGCCGGGATGCCTACATTTGGTGCCCAAGCCACATCA
CGAACCCAATCATTATGTCCGCTAAGGGTCTTAACAAGTTCCCAAAAAGAAGTATCACCTTCCTGTTTTGCTAAAACAAGTCGCCAGATCGTAACTGCGT
CGTTACATGATCCAGTGACCACACGCTGGATTGGCCCTTGCGCCCCTTGCGAGCCCAATGAGTTATAAGGTGCCCAGCTCACAGATGTGCAGCCCATTCC
CTCGTTTGAATTGCGAAAGCTagacgacaccacccatccCTCACGCATGCGAGTGAGGAACGAGACCTGTCCATCAGCCGAGGCACTAGCTAGACACAGT
CCGTACTCATAGGGCGCCCAGGACACACTCAGTACAGCTAGTGAATGAAATTTGTGTGAGTGTTTCAGCCTCCATTCCGTTACATTTGGGACTCCTCCAG
CTCCTTGCTGGATTAGCTCCTCTCGATAAATGTACACTTTTCCATCTTGAGCAGCCAGTGCCAGTACTGCGCCAAATTTTGGGTGCGCCCATGCTGCGCG
ATGGATAGGGGCCGCCGAGTCGTCGCTTAGAGATACAACATGCTGCAACGCGTACagttgttgttgctgctgctggagCTCCATTCCATTTTTATCTTCC
ACTTGATCGTCTTTATTTCCACTTAATGCAATTGCTTTTGACACATCGTATACGCGGAATGTCCGATCGGACGAGCACGTGACCAATCGCTTGCCATAAT
AGTCCAGCTGAATGTCGTAGATCATGTCGTTGTGCTCGGTATCAATGCTTGCTGTAGGGGACTGGCGCATCACCATTTGTTGTTTCTGTTGAGCATGGTG
AAGATCTTTACGGGAACCGGCAAATTGCGTACTCGCTGCCGCGGTGCTATGCATCCTACTTACGAATTCCACTTTTGATCGAGATACTTAgttttttttt
ctcaaaaTACTGTGAGTCAACATACCAAATTCAAATATTGAAATGCTGGCTAGCTAGTCATGTTTGCAGTTAATGGGCCAAGCGGGCCGACGTCGCGAAA
CGAGCGCCGAGTTAGAAGCAATCAACAGcgggaggaagaagaaaaaatcaaGAGACGCTGGATCGTGGAAAAACGCAAACACTTCTTTCTAGAAAAACGT
GAACGAGTCGACGTATCTCAGCAAGGCGAGTGATTTCGTTTGCATATGAGGACAAGTGTTGCATCAATTTAAACCGTTCTGTTGTGCATTGCAggtaata
aaaaaatgaaaacgGTAGCAGCATTGTCAGATATTTTCAAGGTGTGCTCATGAGCTCTTAGTCGCAAAAGCTTCGCTAATTCTGGCTTGTGTTGGTTATG
CAGGGATGCCGAATCGTGTTTAATGGTCGCACCGGCAACGTAACTTCGTGCGTAAACTTTTATTAGAAAGTTGAGAGCTTCTGACTCTAATATGTTCTTG
CCAGATATTACTTGGCGAAACTGGTGCAAGAGCACGGGGGTAGCGTTGGGTGCGTACTTTTTCCCATTTGTCTAGCAAATTTTACATGATTTGACATGCT
GGCCGGTAAAATTAGCTCAACACTGACCACCTCGCGCGTAACACACATGATCGGCTCGAATCTGAACGGATCTAAAGCAGATAAAGCGTTGATGGTAATA
CATAGCAAAGGCGATTGTCTAATCATCATAATCTAATGAACACTTTATGTCAGGGTAATGCTAAGGTCAAGTTTGTTCGTCCGGGTACGGTTTTAACCTT
TGAGGGCCAGCAAATGTGACTAAAATGTTATTTTAGAATGGATCTTGCAGTCTATAAAGCGCAACAAGCGGCTATCTGAATTCGAGTTTCTTGTCTACAA
GGATCAGGCTCGTTTATTGCTGCCATTTTCTAAAGCAGATTCCATAGGTCCGTCCTGCAAGAACGACCTCACGAACAAGAGAGATGGCAAAAGTAACGTA
GTGTGATAAAAAGAATATATCATGTGCAGGGTCACTACTAACCAAAGTAGCCTTGGCAATTGCTACTTAGACTTTCAATTGCCACCGTATCCTCAAACAG
CAAACAGCCTATTCCCCATATCGCACGCCTGTCGTATCCTGATCTAGACCCCATGAGTGCCACGTCTAACGCGATTCTCCACACCGGATAGGGTGAAGTT
GCAGAAAACACGAGCTACGATAGGCTAACTGGACTATACGACGTTGCTTAGCAGCACTTTGAGCCGCCATTAGAAGAAACTTGTTGGCCGGGTGTAAGCT
TAACTCCAGCCTTTGGCGCCACAGGTGCATTGGCCATGCGTTTCTTGATCTGGGCGGCCATCATCATAAAGGCCTTTTCAACGTTGGCAGCATTCTTCGC
ACTGGTCTCCAAGAACTCAATCCCGAGGCTTTCGGCGAACTCTTTCGCGGCATCAGTGCTTACCACACGCTTAGCCGTCAAATCGCTCTTGTTGCCGACC
AGTAGTTTGTTCACATTCTCACAAGCGTATCTGTAATCATAGCGGCACAGCAATCAGCTCTTTTCTTCAGGTATTGTCGGTGCGAAAGATCAAGCGCACC
TATCGATCTCATGCAGCCACTGTTTGACATTATTAAACGACTCTTGATCCGTCACGTCGTACACGACAATAATGCCATGGGCACCGCGGTAGTAACTGCT
GGTAATCGTGCGAAAACGCTCTTGGCCAGCAGTGTCCCACTAGAAAAGCACCAATGTATATATAATGCTTTTTGTCAGAACTATCCAAACAGCTTTGCAC
CCAATGGCAACACATACGATCTGAAGTTTAATGGTTTTGCCGTCCAATTCGATCGTACGAATTTTCTGCGTAGCGTTAGCATCAATCACATAAGCAATCT
TGAAGACACACGAACGGCATCATTTTGCTTACAAAGTCAACGCCGATCGTCGAAATGTAACTCTCCGTATACGTGTCGTCTGCAAAACGTAACAGCAAAC
ACGATTTGCCGACACCAGAATCACCAATCAAAAGCAGCTTAAAGAGGTAGTCGCTAACTCACACAAAACGTGTATCAATCAGTggaccttcttcaaaagc
tgcGATAAATCAAGCTAAATATGCGATCTTGCACGTACTATTCTGGGTTCATCTTGAACTAAGGCGAAGACAGCGGTGTAAATGATGCTTAATCTCTAGC
AGAGTTCAGCACTTTCATCAGTCTATAGATTCTTCGATATGTAACGGGCCCTCTCCTTCCTCCCTGATATATTATTTTTTGGATTAAGGAAATCCAATCA
ACTCGATAGCCGAAGAGCAGGGTAGAAGGAAGGGGCGTAGCATAGTCACATTTGGCGTTCATGTTTCATTTAGCACTTACACAGTAAAGAAGAGGGAGGT
GACTGGCACGTTCAAAGAGTCTTGGGTTGTGTGCTCCGGGGTTTCTGAGAGAGAAGAAGGAGCCGCCGTTTTTTACCATGAGGTTTTTCCAGCAAATTTT
TAGGTTTTAAAacggttattaccaatcaaAATTCCCATCGTGGCTGCAAGAACTCGATGTGGAATACATA