Description :
From Genome Similarity Track
Location :
Scaffold_466:14836- 20599
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_466-snap-gene-0.10Dynein heavy chain

Sequence
5763 bases(100 bases per row)
GAACACATTCAGGAACGATGCCAGCGAGATTTCGTACATTTTCATGATCGTCGATAGCGCTGACATCGCAAAGTACATGATTGATCCTCGCACAGCCACT
GGTGTGTACACTGCTCTGGCTTTTGTAATCTCGTCTTTCGTGAAACTAGAAAGTTCGAGCTTCGTACCAATTTCTGTCGCTTTGTTCTTCGTCTCATCCA
GAGTCGCAATGAGCTCTTCATTGTCAAGGATATTACCAGTACTGTTCGAGAGTTCGCGGAGTAAGGTGTCTTCCAATTCGACAATCATCTGGGTATTCTC
GGACATCTCGGTCACCAGATCGCGGTATTGCTCCTCTAGGTCTGGCCGCTCGTGTGCGACGACAACATTGAGCAGCTGGTTTGCAAGCCCACCTTGTGTT
ACGCTGTAGTTCACGATCATCGTTTTGCCCATCACTTCAGGCGAATAGTGCGGATTTGCTAACTTGGATGTGAAGTACAGGCGGAAATTGGGATCCCATT
CCACATTTTTGTCTCCGAGTTTGATGAACCGCTGCGATCCTTCCATAAACGTACTCTTCTCAAGCACGGGATCCAGGATTGGATCCAGTTCTTCGTCGAC
ACTTTCGAAGAGGAATGGGTTTCCGAATTGAATGGCAAGCTCCAAGTGCTTCATGAAATCGGAATCGCTAAGTGTTTTAACTGTGAGATTGTTTTTCTCC
TCCTTCTTCTTGATCCAGTTCACTGCTTGCTGTTGGGGGTCAATACACAACGGGAATCGACTCGCCTTCGTGGTCAGGATTCCGTTTTGTACCGAGTGTT
CATCCGCTGGAAGCCCTTCAGAAACCCATTTTTGCATTGTCGCATCATTGGTTAGTGAGCTTTCTAAACGGAACGGATCGGTCACTGGCAGCTGACGAGA
TGAAATGTCTGCGTAGAAATCTTTATAGATGAGTTGGGTGCGGTAATCAAAGCTAAACGCACCAGCGTAACTCAGGAAGCTCGCAGTAAGAAGACAGTCC
CCAATCAGTCGCTCTCCCTGGAGATTCAAGTTGTCGACATCTTTTGTCCATCGACCCTTTTCGGATGCCAAGCCGGCAAGAAGCTTGCTTGCGGCTGCCA
GACGCTTCTGCATTTGATCTGCCTGGGATTTCAGACCTTGCAGCTCCGAGTTTGCTTCTTGGAATTGTTTCGATAGCGTATCTAATTCAGTTTTCAGGCG
CTGCAACGTTTCGGTCAAATCAGCAAGTTCCTGCTCCTTGACCGCTTGCTCTTTCTCCATGGTCTTGACTTTTTGCTTTAACGGCTCGACGTTTTTTGCT
ACGTCATAGTATTTCACAATGGCGACAAGCCAAATCAATAACCCTGCTCCGGCCTTGGAAATGGATTTCATGTTTTCCACATTCAGATCCGGATTCTTAA
AAAACGTTTTGATCTTTGTGATCATCTTGGACGAGATCTTGTCCTTTTCGTACTCTTTCAGCAGAGTAAGCAAGTTCGGGTTACTGAGCATGACTTTTGC
TCCTTTCCAGTCCAGATCGAGCTCCTGTCCTGTCGGCTTCAGAATCAGCACGCACATGCAAACTGACATCACTAGAGGGGGTGGCGATGCAAACGACTTG
ATTTCCGTCAGATCCGCCTTTGAGAGATCTTGCAGCGCTGCAGCAGCAGCTTCGACCGCAGGAAGTGCTTCTAAAAGAGCAATATCGGCCTCTTCTTTCT
CCTTCGCGATCAGCACCGACGCTTTCTCGCACTCGATTTGTGTCACTGACGCCACTTCTTGCTGTTTCGTCGCCACAGTGGATTTCTCCTCAATCGTCTT
AATCAGAGCTTCACAGGCTAACGTTTTTTCGTCGACGATCACTTTCTTCTCTGAGAGCTCGGCTTGCATCCGATCGACAGCCTGTGACGCTTCATTCAGC
TTCGTCAGCCCTCCTTTCAACCGAGAAATCCCTGCGCTGACTTTTTGGTTGTTCTCCTTCAATTGCAAGCGATAGTTCGAGATCAGGTCCAAGTAATTCT
TGGGTGTGACATAGTAGTATCGTCGAAGTTCTTCTGCGAATTGGTGCGCGACCGTGACAACACGCAAGTGAGCATGCACCAGATGGTTCGTTACCTGGGC
GCGAAAATCTTCGCGAATGGTTTCTTCAGCAAGGAAATACTGCGCGACGTTACGAAGCGCATCTTCTGGCCACGGAAAGAACCAGTCGATAACAGTGGCA
GAAACAAGGCCAGGGAAATTACGACACCGCGTCCGCAGAGTACTTCCAGAGGGTGACATCGCCAAGATGATGTGCAGATTTTGTCGGCAGCGATTAATAT
AGAACTTCCAGCAATTCTCACTGGTTTCCACCAGACCAGCAGCTTTCACTTCATCGCGCACCATGGACGATAGCCCATCCTTCTCGTCCTGCTCGAAGAG
CGCTGGCACCATCCCTGTGGTCAGCATGTTATTGATGAACTCAAGAAAGCCTTCTTCAACAGCATGTGCATCCGTGAAGAGGAACACCACTTTGTTTTTG
CCCAGTTTGCGGTACAGATCCTTCAAATTTTCGCGGAACTCGTTTTCGCCATAGCCACGCGTGAGGAAAATCTCAAACAGGTCAAATCCAGCAGTAAATG
CTGCCAGGCGGGACAGACTTTGCTTGCCGCTTCCACCGACACCGATCAGCAGTGCATGGCCCAACGGATTCCGAATGATACGCAAGATCCGAGACAAATG
CTCCAAAGCCATTTCGAACAGCACCAAGGCCATGGGTTTGTTGTCCAGATTGTACGTCTCAAGCGCTTCGTCGAAAATGCTCCGAATACGTTTGTAAGAA
TCCATATCTTGGTATAATCGCGGGTCTTCGGTAGACTGGCCGGTAATGCGGCCAATGCAATCCGCATAATCACCAAAGATGATCGGGTCAACCATCGCGA
AATCAGCCTCTGATGTAAATGTTTCCTTTATGATCGCACCGATTGCATCATCGCAAACGGCATTATCGGCTTCGCTCGTTAACCGATCGCAAAAGATTCG
CTTGATCTCGTTTCGCCACAGACGCACAATCGTTTGGGATTTGTCAAATTTATCTGGAGTCGCCAGACAGATCCCCTCGCAAACTCGCCCCAAATCGCGT
AGATTGAAGATGTAGTGAAACTTCGATGGTGTTGGCGGCAGCTTCTCAACAACAAACTCAAAAAAGCGGAGCAGCGCTTCAGTCATTTTTGACCCTTTGT
CTTTAATGTCGTCGTTGAAGTTCCGCAGATACGTCGTGACAATCGAGCCGTAAATCTGTTTTAACACTTCTTTCGTTGGCGGAGTAAGGTTGTACACATT
GAACTGCGCGACGAAACGTGGATCCACTTGGTTTCTTCCACCACCTGGCGGACCCATAGCGCCAATAAAGAGAAGGTCTTTCAAGATGCGCAAATCGAGC
TCTTTACCACGGTCGTAAATGCTTCCTCTAGACATCACAAAATGCAGCAGAGCAATAGGTTGCTGGGTACCGTAGAGATCCACCTTGGGCATGTTCAGAT
CATCAATGAAGATGATCAGCTTTTTACCCGCTGGCGGACCATAGATTTTCCCCGATCGCTTGTCCACATTCGCTTGCAAGTTAGTTTGAACGTCCAGACT
ACTCGTTCGACTAGAAAAGTTCAAATTGAGTGTCGAACACGTTTGCTGGTCCAGATCCTTGAGATAGTTTTGAATCGTCACGGTCTTTGCGGTACCGCTT
TCGCCCACAAAGAGGATCGGTTTCTCTGTTTTCATGCAACTGGACAAGATGAAATTGTATAGAACGGAGTCTGTGGTCGGAACGAACACCATCGAGAAAT
TGAACGGCGCAGGCTCCACGTACGGGACCACACACGACTCCCATGCTTGCCACTTGTGTGTTTCAACATTGTAAAAGTTTTGGTACAGATTTGTCACCGG
AAGAGAGCACTCGGCAATTTTCTTCACAAACTCATCAAATCGAGGACGACTGCTGCCGAGGAGTGCTGCACCGAGTGACCACATCATGCTGAAAACAAAG
ATACCTTCTATGTCATTTCGATTCAAAGTTGGGTCTAGACCTTCAGGAGGGAGAAAGGAATCCAGCGCATTTGCGAGCTGTTTGCACATTTCCATTTTGC
TGATTGGAATCACTTGTTGACATTTCGCCACAATCTCATCCTTGTTGAGCACGCCTTCAAGAATAAAGTCGATACACTTCGGCACATACTTGTCGAAGAG
CTCAAGAAAAAGCGCACGCTCCAGAGGTGGTGCGACTGGTACTCCATCTGCACCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTTGAG
CCAGCGCTCATAGTACGGGCGATATCCGAGATTTTTCGGGTCCACCCACACCATACCACAACGACTGATTGTAGCGGGAGACGCATACTGCAAATCGAAA
GTCTCGCAAATCATCGAGCAATGTGTCTGCAATCGGATACGCTCACCATTTGGCAGCGTGAGTAACTTGTTGTCGTCCATCACACTATTCATGTTTTCGA
CCCACACGGCATCGACGTCGCCATCGTAGATAAGCCAGCGTTTCTCGTTTTCACGACCTTGAGGAAGAGGTTGGTTCAACTCTCGAAACAGCTTGGAGAG
TACCCCATCTGTCCAGTCACGCGTCACAGGGTCCATCGTGCCGTACAGCTCTGCAATTGGCTGCGCTTTCGGGTTCAGCACGAAGATTTTCACGATTTCG
TCGAGCGCTACTTTGGATGCCGCAGCAAGAGTATTCAGAACAAGCGATTTACCTCCACCTGTAGGACCGACGATCATCGTTGTGTGTCGAACGAGCATCG
TCTCATACATTTGAATAATCTTGTCAATCTGTTCATTGTACACTTTCGTGTCTGTCGTCACATATTCTCCGGCCTCAAGCTCTTTTTCAATCGCAGTATT
CAACGCGGCGTAACCAACACGAGGGCAATCTAGTCCGGGGAAGAGATCATTAATCAACCCGTGGAAAAGAGGCACATCTTCAAACACGAATTTCGGCATG
TTGCTATCACGAAGAGCTCGCATCAGCACCAAATCCTCACTCATTGAGCTGTATTCGCGCTTCAACGACCCTGCCATGACCAACACACTTTTCAGGGCTC
GGAGACCGAAATCATAGTGGTATTGCTTCGACAACTGTTCACGAGACAACTTGTACAGCACCGTCATCTTCTTTGCGAGTGCGACAGCGTTTTCAAATCC
TTCCGAGAACAGCATAATCTGGCAAATTTGCAACAAATCAGGAACGATCATAGTCACTGGGCGGAATAGCGCCTTCAGATTATCAGGCAACTCTGTGCGT
CCAGCATAACCTGGATTCATTGTGATGAAGAAACCACATGTAGCAAACCCTGCCGTACGGTGAATGGAGATCTCAGTCCCAAATCCAATATCGCACGTTG
GTTTGTCGTAGTTGAGAGCATTCTGAATGGCTCGAAGTTGAGCCGATACGACCGAAAGCACTTCAATGTTGATGCGATTGAACTCATCGAAGCAGCCCCA
AGCACCGACTTGCACCAAACCTGAAAAGATACTGCCCATAGCTTTGTAATCCAGGCCTTCGCCGCAGTTAATGACGTAGCATGGCAGAGCCAATGACTTC
GCCAGATCTTTCACTGTCTCCGTTTTTCCAGTACCAGCAGGCCCAGCGGGGGATCCACCAAGTTTGAACGTAAGCGCTTGGGTAAGCGTCATGTAGCATC
GATCCGTCAACGGAGTAATCACGAGACGGCCATTTAGACCCATGTACTCATAGCCATACCGAA