Description :
From Genome Similarity Track
Location :
Scaffold_327:14831- 17922
Transcript NameFunction/comments
Phyta_totarag7156hypothetical protein PHYSODRAFT_360793
Phyta_totarag7157hypothetical protein PHYSODRAFT_508758

Sequence
3091 bases(100 bases per row)
TGACACCTTCTTTAAGGCCGACAGTGTCGATGTACGCCACAATGATCGTGGTGTCGTCGATGACCTGTTCTTCTTTCATCCAGCGGCGGTTGGCCTCCAT
GATCAACAAGTCCACAGCCACCTTGGGATCCTGTTGCCCCATGGCCATTTCCATGCACTCTTCGTTCGACATAAACTCCCACAACCCATCCGTAGCCACA
ATGAGGCATCGGTCGTTCTCATCCAGCCACCGAGAGGTGAACTCGGGTTCGGACAGCACGCCGGCAGTGTGCGCAACGGCGTCACCTAGCGAGCGCGACA
TGGCGAGACCTGGAACATCCATGTGTCCCAGCCAGACACGAGGAGGACCGTCAATGCCGTCGTCGTACTCCACTGCAAACACGCGTCCACCGCTAGCAAC
GATACGGGCCTTCTCGTCCGGTCGGTCGGGCTTGTGGTCAATGGAGAGTTCCTGGCTCCCGAGGGCCTCCGGACCCGAAGGACCCAGCATCTTGACGAAT
CCGCGAGTAATGCGCGAGTCACCGACGTTGCCGACCACCACGAGGTTATCTCGCACGACACTCACCACAGCAGTCGTTCCACTGAACTCCGTGTCAATAC
TGGGGTCACGCAGGACAGCCTGTTCCACAGATCGCAGCGTGTCCGCAATGGCTGTACGCAGACTCTCGACATCTTGCTGAAGATCTCCCGATCGCCCGAA
TTTGTCGTGTGCAAAAAGCTCCGACGCAAACCGTTCGCGAATAGCACCCGAAACCCCGTCCCCAGCTTCGCCGTGGCCGTCAAacacacacagcagcagc
gtctgcgtgTTCTGGTCATACTTGATCACCATCGCGTCCTGGTTCTTCTTGCGAGGGTTGTACGGCGCGTAGCCCTTCTTGGATAACCCAGCAAAGGTCA
CGACCGCGCAGGTTCCGTCCGCCAGCGCCTGGGCGCTGCTGTCCGCGTCGTCAatggtagcagcagccatgCCATCCACGAGTTTGTTGTCGCTGACCAC
GGACAGCCGACGACGTTGCAGTCCAAGCGAGTGGTCGCCTCCCGTCTGCGCGGCCAGGATCTTGCCCGGCGTCTTGATGGAGATACCCTTGGGCGACGCC
ACGTTGGTGGCCGTGGCCTCCTGCTGGCGGAGCTTGATCGTCGAGCCCATCTTCTGCATCGGTCGGGCGGCCATGATGGGTTTCGAAGCTCTAGCAGAAG
CTCAGAAGTGAGAGGAAGCAGGCGACTGGGACGCTGCAAATACCAGAGTGATCTCGGCTCCGCTGCTTGGCCGGTTGGTGCACGAGCCAAATCTGTCTGG
ACGAGATGAGACGAGTTATTATATCCTCCACAGAGCTAGTAATTATAGCCGACGAGGCGGCGAAGCGCAAACGAACCGCCGCAAGTGATTCTGTGGCCTC
TTGGAGGAGACCAGTGACCAGATCGACAGGCCAATCACGAGCGGGCCGTTGCACGAGACCAAGACTTCAACAGGCTAAGAAAAGCGAGCGGTAATGGAGT
TTGACGCCTTTAGACCCTCGGCCGTATTTCCACAGCTCACCTATTTCAATGCTTTCTGCGACCTTGGGCTGTCGAGTAAGTGAGATGCTCTGAAGATACA
AGATCGAGGAGTTACGGTGCAACTACAACGTCACTCTATCGGAATTTCATGCGAGTGACataaatgtagccatgtgaCGTGCAACGATTTTTTGTAGCCA
TTGTACGAGATCCGCTTAGTCGCTATCGCTTTCGTCCTctgaggaggacgacaaACTGAGTGATATCGTGTTCGGggcctcttcgtcgctgtcgctcgag
tcgctggagctttcACTCTCGGCAGTGGCCTCGTCGGCCTTTTCGCCCTCCTCCAACTTGCGTTTCTTGCGCAAACTCTCGACAtcgtccacgacctcgt
cgtcgtacaaGGCCGCTCGCTTTTCAGgcagcttgaacttcttgcGCAGGATCTCCATCGCATCCGGAGGCAGCGGGTCTCCCGTTTTCCAAGACTCGGG
CAGCGTGATGCCGTGTTCAGAGAAGAAATTCCGGCCCATGTagtgcagcaacgcgtcgaGCGGCAGATCCACCGGGTCGCCCGGTTTCCATCCTGGCGGC
ATTTGTTTGCGGATCTGCGCGTCGCTCGCACCCAAGCCAATCGGGATATTAAGCTTCTCCATAGCTTCGCCGCCATCGCCTTCCTGCTTCACCCGTGCTG
CAGTTGACGTGTACTTCTCTGGGCCCTGAGTGACAATCTCAGCAACAATACCACGACTGAGCACACCAGCACGCATCATGTGCTCCTGCGGTGCTGGGGG
CATAAAGCCAAACATCGGGAACTGTATAATAGCAACGACAAATAGTCAAATATATAGTATTAACAACGGTACATCCATCCACACAGCAAAGCACAGCACA
CCCAACGTACTCCAGGCTGCCACTCTTTCGGTGCCGATGTCGTGCCGGCAATACGGTGCGCATATGAAACGATGTCGCGAGGGTCCAACACCACTATAAC
CACATTACACCACGTCAAAAATAACTGATCAGCACAATGTACAAATGAATcctcagcagcaccaaatGTAGCCACCTTTGGATTTCTGCTTGgcattctg
cagcaccacacgGTGTTTCCTCAGCACATTGGCAATGTCCTCCTGAGAGCGACGCAGCTGAGTTGCATATTGTaccaccttctgcttcttATTCTCGATC
TCCGCCTCGACCCGCAGCAATTCCTTCTGCGCCACCTGATGTCGAGACACTAAAAAGCTGCCAGGTCAGCTTTAAATCGTCGACTCCTCCCTCTATTTCT
CCCCTGACGTACACTTCTTCACAGCTGCCAGCAGGTTTCggtccttctccagcaccttgttgaACGTCTCGTTCACTGTGCGCAGTCTCGTGGCCGTAAT
AGTGGACGGCGGGCTGCGGTTTTTGGCATTATTTAGGTGACGTAACGTGAGAATTATGGCGCGAAAACCTGTGCGAATAAGAGGGTGGGTGGCTGAGGAC
GTACAGAGAGGCGGTGTTCAGtgactccagcagctttgtcACCAGGAAGCGgtgctcgtgcagcgccacctccacctcctcgcGGATGCTC