Description :
From Genome Similarity Track
Location :
Scaffold_158:14830- 17545
Sequence
2715 bases(100 bases per row)
GCGAGTCAGCAACCCCCTGCGGATCATAGTACCGCTTAAGACGTCCAATGTAGAACGTCGGGTGCGTCGTCGTTGACTTGGGCAGGTCGATGGTGTACGA
CGCACCATGCCTGACCAGGACTGCGAACGGTCCAATGAAGAGGTGCTTCAGCTTGTTGCTGTCGACAGAGCTGACAGTGTCTATCGGTAGGTCCCTCGTG
TCTAATAACACTAATTCGCCCTCCTTAAACACAGTTAAGTTTCCTCTTCCATGTTTGTCAGAGTACTCCTTCTGTCTGTCCTGGGCCGCTGCCATGGCAT
CGCGGACCCTGCTGATCACACTCAGCCTGGTATTCACAAAGGCCTCCACTGCTTTCCGCAGCGAAACCGGTCTCACATCTGAGACCAGGGAGGAAAGAGC
TTTCCGAGCCTCCCCCACTTAGAATAGAGGATGCAGTGTTTCCGGGAATAGTGAGAGGCACTCTAAGGCGATGAAAACCGATCAAGTAGAACGGCTTGAG
CCCCGTGGACGCGTGCGCTGCGTTATTGAGCGCAATCGCAACAGCTGGAAGCTGCGTCGACCACGTACGTGGGGCTCCCACGCACACAGTGCGCAAAGTG
TCCTCGAGTACTCGATTGACGCGCTCCATCTGGCAGTCTGTCTACGGATGGTCCGCGGCGGACATCTGCAGACGAGTTCCAAGTAAAGGAAACATCGTTT
TCCAGAACGCAGCCGTGAACCGCGGGTCTCGGTTCGGGACAATCGTCTCCGGGAGACCGTGATAGTGGAACACGCAATCGACGAACCGCCTCGTGGTCGG
TTCGCCTGTGACGGTAACGGGCACTGGAGCAAGATGTACAATCTTGCTTAGCCAACACACGAACACCAACATTCGGTGTTGCCGTGGCCGTCCGCGGGAA
TTCTACGATGAAGTCAAGACTCATCGACTTCCAACAGTCAGCCGGAACGGGCAGGCTCTGTAATGGAGTCGAAGCGTGCCCTGTGGCTTTGACCCGCTGA
CATGTTTCACATGTCTTCACGTATCGGGCGACCCACTTGTACATATGGGTCCACCAGAAGGCCTGAGAGACCGACAGGAAGGTCTTCTCGCGGCCCAAGT
GGCCGCTGAGGGGCGCGTCGTGCGCCTCCGCGAGGATATCGAACTTCAGATCCTCGTCGTTGGGTACGACCACCCGTGGAGGTTGATTGGGCTCCACTCG
GTAATAGAGGGGTCCATCCTTCAACTCATATCGGTGAAGCCGGGAGCGCTGTCGCGACGAAAGCCAGTCGGACTTTGCGTCCGTTCCTGCTGCTAAGAAT
TAGACGATAGGCGCGACAGCCTCATCATCCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGTGTGATGTGAGCCAACCCGTAGTCTG
GACGCCGAGAGAGGGCGTCTGCAAGCACGTTGGGCTTGCCCGGCTTGTACTCAACGCGGAAGTTGTACTCCGCGAAAAACAGCCACCGCGCCATCCGTTG
GGAGAGGTGAGGCGAATTCGTCACCGTCCTCAAGGATGCGTGGTCTGTGTAGATCACAAAGGGCCTTGAGCCCAGAAGATGAAGCCAAAACTACACAAGG
GCATACTTTATTGCCAGGAGCTCCTTGTCGTGAACGGGGTAGTCCCGCTCGGCGGCTTTGAGCTGCTTGGACTGGAACGAGATGACGCGCTCGTGTCCAG
CTGCATCGGTCTGCAGCAATGCACACCCGATTGCAAAATTATAGGCGTCGCAGACGACGCTGAACGGCTTCGTTTCGTCCGGCAATGCCAGGACAGGAGC
CGCTTGGAGACTGCCCTTGATGTTGTCAAAGACATCCTGGTGCTCTCGCTCCCAGCGCCAGTCGACGTCCTTCTGAAGGAGGCTTAGCGAGGCTCGTGTA
CCCTGCGCTATACTTGTGAAGGTAGTTGGCGAAGACCAACCACTTTCGAAGATCCTTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTG
TCTGGGTCAGCCCGAACGCCCACGTTGCTGACGAAGCAACCGAGAATCTTGATATCTGGTGACGCAAAGACGCACTTGTCGATGTTGGTGTAGAGCTTGT
TCGCTCGTATCACGTCCAACACTTAACGGGTGTGTCCCAAATGCATCTCCATGGCCGTATTGTCTCCCTCGACACGGCTATGGATGATGATGTCGTCGAA
GTACGTTTGTACGAAGGCACGCAATGGCCTGAACAGTTGCGTCACAAGGCGGTTGAATGTCGACGGGGCATTGGACAAGTCCTGCGGCATTATGAGCCAC
TCCCAAAGCATGTCGCTTGGAGTGCTCACCACGCTGAGCAAGATGTTGCTCTCGCGCGTCAGGATCTGGTTGTATCCGTCTACCAAATCCAGCGCACTGT
ACTGTACGCATCCGGTCATGTTGTTAAGCAACCCATCCATTCGTGGGATTGGTGTCTGGACCGGCACCGTCGCGTTGTTCAGTTTGTTATAAGCGTGAGC
AATACGCCACTTCCCGTTCGGCTTCCGAATGCAGAAAGTTGGCGTCGAGTGCGGGGACTTCGACTCCTGCACCACGCCTGCCTTCGCTTTCGCAGCGAAG
AAGGCATCGATGACCTCGCACTGCTCGCGTGGAGCAGGCCATTGTCTCGTGACACAGTACTTTGTGCCAGACACGAGATCGATCTCATGTCGTACGCCTC
GATTCGGTGGGAGTT