Description :
From Genome Similarity Track
Location :
Scaffold_9:14830- 16241
Sequence
1411 bases(100 bases per row)
AGAGCGATATCCATGAGTCCGAGGCCTCTCGCTTCCTTTGGAGCATAGACCAAGGCCACGTTGATTTTGTGGCGCGTTCCGGAGGTCTTCAGCGTGCTGT
TCCACAAGAAGTTTTTCTGCAGATTCACCAGCTGGGTTAGGATTGCTGGAGGCATTTTCATGTACGCTGCTGTGAATAGTACTGCCGGTAGTACTACCGT
GTTGAAGATAATTACTTTCTCTTGGATTGTGAGTCGCATAGGTAACGCTGTTGCCAGACGTCTTTGCACTGCTTGCAACCGGAGGTTCCAATTCACTTCC
TCTGTTGGACGCACACCAATTTGGATGCCAAGGTAACGAGTGCTTTCATCTTGACGCAGTACTGGGATCCCTGCGGTCGCTTTTTGGTGTACTGCCTTGT
TCAGAAAGATGAACTTGCTCTTTTCTGGCTGTACTTGAAGGCCTGAAAGTTCCTTGTACTCGCGCAAGATCTTGAGGACCTCTGTAATTTGGTTGTGGTG
TTTGATGAAGACTGTCGAGTCGTCCACAAAAGCTGAAAAGACATGCCCATTATCCGTTTGTCCCGGCAGCTTGCACCCTTTTACCTGTAGATTGGCTCTC
ATTGCTATACTCAGGGGTTCGACCGCAAGGATGAACAGCAGAGGTGCAAGAGGGCATCCTTGCCTTATACCTGACAGCACTGGATATGCGTCTGACATTT
CCCCATTCACAAGAAACTTCACTTTCGTACCTGTGTGAAGGGTGGTGATGAGCTGGACGAACTCTGCTGCGTAGCCAAAGTTTTCCAACACTTGGAGCAT
GTAGTTCCGATCGATTGAGTCGTACGCTTTTTGGAAGTCGAGCAGTAAGATTCCGGGTGAGTCATCCGCACTCTCCTTCGGGTTGAAATATGCTTGGCCC
AGGTGAGCAAGCATCATAGTGACTGACTTGCGCAATTGTCGCCCCAACACAAACCCTTGCTGTGTATATCCAATGAGTTTGTGCAGGAAGCGTTGCAGCC
TAGCAGCCAATATTGATGCAAGAATCTTGTAACTGGATTGTAAGAGCATAATCGGCCGATAGTCCATCGCGTCCGTTGAGTCATCTTTCTTCCGTAGAGG
ACTTACCAGCGATTCTAGGAAGGATGGTGGAGGTTTAGCCCCTCCCAGGATGTCGTTGAAGACGTCGACAAGCACCTCTGCCATGTGCTCTGGAAAATCC
TTGTAGAAATCATTGTTCAGCGAGTCTAGCCCACCGCTTTTATGACGCTTCATAGATCGGATAGCTTGGAGAATATCCTCTTCAGTGACTGGCGCCATAA
ACAATGCGTTTTCTTTGCTTATGGCTCGCTTGGAGTCCGGGATCTTGGCAAATCATCCCAGGCGTTCGCTCAGTTTGTCCTCTCGAACTGTGCGGTGGCT
CTGACCAAATA