Description :
From Genome Similarity Track
Location :
Scaffold_7:1482970- 1485675
Sequence
2705 bases(100 bases per row)
TGTGTTATCTCATTCGGTTTTACGTCATGTTTGAATCGTGTGTAACCCGAAAAATACAACCCTGACTGCATCGTCCTTGTAGCACGGATGGTGCCAAAGA
ACGCTGTGCTGCAAGTTGCGGCACAGCTCCAGAAATCTACCGGAGAGGAATTACCATAATCCAGTAGAAAGGTACTGGATTGTACCCCAAGCTGATTGGC
ATCTCCAAAATACAGAAGAAATTCGTTAGGTACGCAAAACGAATAAGCGAGCTTAATCAATTGGATTTCTAGGATTACCGCTTTATTTTGTGAGCATACG
TATCGTTAAAAGTTTCAATCTCAATTTGTCACCAACCTTTGTGAATCGAGCGCCAACTAGAAGACGAGACCCCAGGCGCCCAAGCGCAGCCCCGCCAAAT
GGTAAATAGGGCTGGCCCAGGCCAGAGGGTTTCTGCATATCAGGACGTTTCGGGGAGTCCATTATATATCACTTATAGACGAGTGACATACCATATGTTA
TCTCAATTGGTTTTACTTCATATAACACTCGTGTTTTTGTCGAAACCAATCCGTGTGGGCTGTCACCATAATCTACTTGACCTGACAGAATGTTTATAAT
ACCATTTCTACACATTCCTCATATGGTAAATAGGGCTGGTCCAGGATAAAGGGTTTCTCCATTTCAGGATATATTTTGGGGAGTCCGTTACAAATCACTG
AAAGACGAGTTACAAAACATGTGTTATCTCATTCGGTTTTACGTCATGTTTGAATCGTGTGTAACCCGAAAAATACAACCCTGACTGCATCGTCCTTGTA
GCACGGATGGTGCCAAAGAACGCTGTGCTGCAAGTTGGGGCACAGCTCCAGAAATCTACCGGAGAGGAACTACCATAATCCAGTAGAAAAGTACTGGATT
GTACCCCAAGCTGATTGACATCTCCAAAATACAGAAGAAATTCGTTAGGTGCGCAAAACGAATAAGCGAGCTTAATCAATTGGATTTTTAGGTTTACCGC
TTTATTTTGTGAGCATACGTATCGTTAAGAGTTTCAATCTCAATTTGTCACCAACCTTTGTGAATCGAGCGCCAACTAGAAGACGAGACCCCAGGCGCCC
AAGCGCAGCCCCGCCAAATGGTAAATAGGGCTGGCCCAGGCCAGAGGGTTTCTGCATATCAGGATGTTTCGGGGAGTCCATTATATATCACTTATAGACG
AGTGACATACCATATGTTATCTCAATTGGTTTTACTTCATATAACACTCGTGTTTTTGTCGAAACCAATCCGTGTGGGCTGTCATCATAATCTACTTGAC
CTGACAAAATGTTTATAATACCATTTCTACACATTCTTAATATGGTAAATAGGGCTGGTCCAGGATTAAGGGTTTCTCCATTTCAGGATATATTTTGGGG
AGTCCGTTACAAATCACTGAAAGACGAGTTACAAAACATGTGTTATCTCATTCGGTTTTACGTCATGTTTGAATCGTGTGTAACCCGAAAAATACAACCC
TGACTGCATCGTCCTTGTAGCACGGATGGTGCCAAAGAACGCTGTGCTGCAAGTTGGGGCACAGCTCCAGAAATCTACGGGAGAGGAACTACCATAATCC
AGTAGAAAAGTACTGGATTGTACCCCAAGCTGATTGACATCTCCAAAATACAGAAGAAATTTCGTTAGGTGCGCAAAACGAATAAGCGAGCTTAATCAAT
TGGATTTTTAGGTTTACCGCTTTATTTTGTGAGCATACGTATCGTTAAAAGTTTCAATCTCAATTTGTCACCAACCTTTTTGAATCGAGCGCCAACTAGA
GGACGAGACCCCAGGCGCCCAAGCGCAGCCCCGCCATATCGTAAATAGGGCTGGCCCAGGCCAAAGGGTTTCTGTATATCAGGATGTTTCGGGGAGTCCA
TTATATATCACTTATAGACGAGTGACATACCATATGTTATCTCAATTGGTTTTACTTCATATAACACTCGTGTTTTTGTCGAAACCAATCCGTGTGGGCT
GTCATCATAATCTACTTGACCTGACAGAATGTATAAAACCATTTCTACACATTCTTAGTATGGTAAATAGGGCTGGGCCAGGATAAAGGGTTTCTCCATT
TCAGGATATATTTTGGGGAGTCCGTTACCAATCACTAACAGACGAGTTACAAAACATGTGTTATCTCATTTGGTTTTACGTCATGTTTGAATCGTGTGTA
ACCCGAAAAATACAACCCTGACTGCATCGTCCTTGTAGCACGGATGGTGCCAAAGAACGCTGTGCTGCAAGTTGCGGCACAGCTCCAGAAATCTACCGGA
GAGGAATTACCATAATCAAGTAGAAAGGTACTGGATTGTACCCCAAGCTGATTGGCATCTCCAAAATACAGAAGAAATTCGTTAGGTACGCAAAACGAAT
AAGCGAGCTTAATCAATTGGATTTCTAGGATTACCGCTTTATTTTGTGAGCATACGTATCGTTAAAAGTTTCAATCTCAATTTGTCACCAACCTTTGTGA
ATCGAGCGCCAACTAGAAGACGAGACCCCAGGCGCCCAAGCGCAGCCCCGCCAAATGGTAAATAGGGCTGGCCCAGGCCAGAGGGTTTCTGCATATCAGG
ACGTTTCGGGGAGTCCATTATATATCACTTATAGACGAGTGACATACCATATGTTATCTCAATTGGTTTTACTTCATATAACACTCGTGTTTTTGTCGAA
ACCAA