Description :
From Genome Similarity Track
Location :
scaffold_25:148276- 150384
Transcript NameFunction/comments
Plaha_PHALS_13653hypothetical protein F442_14898%2C partial

Sequence
2108 bases(100 bases per row)
ATATAATTGCAATATCCGACGGCGAGTCATTTCAATAATGTCTGTTTTCAGAATCTGTTTGTGCATAAGGTGGACGAAGGAAGGTACGTATGTGCCAATC
TCACCAGGCGTGAGCTATGAAATGCTATTCAGCGTCAGGGAAAGTGTTGGTCTTTTTTCATCCATAGCACTTGGATTATTAATGTTAATTCGCTACAAAG
CCATGCATTATGCAGCTAATTAGTATCGCATTTACCAACATCGTAAAATTTACAAACTACTGTGCGAAATTGATGGCATTTGATGTCTGGTAGAATGCAA
TAAACCGAACTGATTTTTTAGTTTAAAGATGTTACAAGCCTTGTCCGACGGCGCTGACCGTGTGTTGAAAGTGTACTGCATCATATTAATCCGACGGCGC
CAGAACCAGATGCATAGATATTTTTGTATTGTTATCACTAAATCATCATAAATGTTATATCCACACATGTTAGAAAACATTATGAATTAATCCTTTTATT
AGAGTTTCATCAGTGTCTGATGCCTAACTGCGTCAGTTAAGGAAAGAATGAACGTTTTCGGTTAAACTTTTCGTGCCCAAGACGAGGTCAAAAGGTAAGA
AAAAAGAGCTGAAAATTCATATTTACGCTCTTTGATGATGGTAGACGCAACAGCCATATGACGCATTTTTGATTCCACATGCCTGCAGGATCAGTAACGA
GCTTGTTGACACCGATACAGAAAACAGGATAAACCATTCAGGATTGCGAGCCCTCTAAGTGCATGAGGAGccactgagtactgctctTCATACGAAAATC
TATAGTTGATCGTGTTTTAAGGCTGGATATTATACGATTATCGCTTCGAGCCTTAAAAGTCACGTTCaactttgccatatatataaGTCATTCGCTCTCA
GAAATGCTAAATACTTTCTCTCATTATTTATTTCTTAGCTTTTTCTCGAGCGCTATTCAACTCGAAAAATTGAAAGTCCTTGTCTCCAAGTTTTCAATTC
GTGTCATAGTCTTTGACAGTCCAATGAGTTCTATAACCCTTGATCATCGAGATGTGAACAACTCCATATGCATCAGAAGCTAAAAGGTATGACTAATCTT
TGTAACAACAAATAGCGTCGCCTAAAAATCATACAATGTACCTTATAACATTGAACACTAAGCGTGCTCTTGTTGCTGATCCACGTGCCGTTTCGCGTTT
CTCGTATGTACTGCTTCGACTGATATAATTCATACATACAAGATaaaagcggaaagctcttttgTGCTCTTAAGTTTTTTACAATAGCAATAGCTTTATA
AACTACACGAGTTTAACCTTGTCAGCTCGTAAATTacgtgatgatgaagagtgtAACTTGCGGTGAAAAAGACAATATAAATATCTATGGAGCAACTTTT
TACAGCCATAGTCGTTAATAGTGTCTGTCGTCCATCCAACATGTATACATAGTAGTTGCTAGTTTTTCTAGAATGCGTCACTAGCTTTACGATGATGATC
AACATGGCCTGGTTGACTACGAAATCCTTCCATGCTACCATGTGGTTCTTCATTCGACTCGAACGGTTCATCATTGCCGCGATTCTCATTCCCGTTTCCA
CGATCACTGTCACTTCCATCTTCATCTCCTTCGCCCTCTTCACCTTCTCGATACTTAAGCAAACTTCGTTCAACAAACGGAGATGTCGTTCGATACTGGT
CCGCCACCCAAATTCGAAGCGTCTCTAAGAATCGACCGTCTCCTTCACTCACGCCACCTCCCACACTTCGCACTGGTGCCTGATTATCGTCTTCCAATTC
CCACTCAGTCTTAACTTCGATGTCTTCGCGATCACTACACACGCGCATAAGCAGCGGTACAAAGATCTTACGCACATCACGCCGAATGCTTGGGATCTCC
AATGCACGTGCTTGCAAGTCTCGTGACGTCTTGCCGTTAACAATGTCAGCTAGCCAGTTGAGacaaaaattaaatttcCGAAGATTTGAGCGACATATTT
CAAACCGCATGAGTTCAAGCAAATCAACTTCTTCAGCTAAACGAGGGCAGCGGGCGAGAGTcaactcttgaacacggtaAAAGAGTTCATCAGAGTTCTC
AAGACCAT