Description :
From Genome Similarity Track
Location :
Scaffold_127:14825- 17482
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_127-snap-gene-0.21Animal inward rectifier K channel (IRK-C) family protein

Sequence
2657 bases(100 bases per row)
ATGCCCGCCAGTAAGAAGCGCATCCAACGAGGCGCCGGAAGTGCGCTTCCGTCACAGCGCGTGCCGGCaGCACTGCGGGAgTGGGTGCACATCTGGCATG
GGGTGCAGGTGCGACCGTCGCCCGCGATTGGCGGCGTGGCGTCCAGCACGACCATCTTtcACTCAGGCTCACGCATGGAGGAACTGACGTTCTGGCAACA
GTTTGTGCGCCTGCCGTCCAACTCaCTCTTCAGCACTTCACTCCATACGGTCGCGAATCCGCGCCGGCGCTACAAGGACTTTCTCTACGTGTTGCTCAAC
ATGCGTTGGGCGATGCTCATGACCGTGCTACTGGCTGTGTTTCTCTTCAATATTGTGGCGTTCGCTGTGCTCGTGTATGCTACGTGTGGCGACCCTGACT
CGCTGCtcAAGAGTTTCAACCTCAGCTACCAGACATTTAGCACCATTGGCTTTGGGATCGTGTACCCGACCACCACTTGCAGTAACATCGTCATGGTCGT
CGAGTCATTCGCGTCAATGTTGGTCACATCGGCCATCACTGGTCTTGTGTTTGCCAAGTTCGCGAAacCCAAAGCAAAGGTCGCGTTCAGCAAAGTCTGT
GTTATCCAACCGTACGGAAAGAAGTATCTGGCATTGGTGGTGCGGGTCGCTAATGCAACGCAGTCAAAAGACGTGACcCATGAtGTCATCATGGAGTCGA
ACTTCAAGCTCAATCTCATGCGTATAGAGCGCAAAGAGACAGCACACGATGACTTCAGCGAACCGAGTGTGCTTTGTTCGTACAATCTGAAACTATTACA
GCACAACTTCATCACGTTTCGAATGGGAATCGCcgTGGTCCATGTAATCAATGAAGATAGCCCGTTGTATGGACTGAACGAAGCCGATATCGCAGCCTCC
GATATGATCTTGGAAGTTTcgATGTCTGGTGTCGATTCAACGCTACAAGACACAGTgACCGAGCGATACACGTACACATCAGAAGAGTTCAAATGGGGCT
ATAGGTTTGCTGAACTGCTTGATTTtGACGAGAAGAATTCAGAAGTCATCATGGATTTtGCCAAACTGAGCACTATCGAACGAGCACCGATCGATGAAGC
GTTGTACGTGCACTCCATGCCAATTGTGACAGGAAGAGGACTGTCGATGCGGCTTGTCCGCAAGGGTGAGCAGAAATCGCAAATACTGAAAGGCATTCGG
GCAAAGCGATCCGCCCTTGATTTGGAAGGAACTGGAAGTATAACTAGTCAGGACAGCACCTCCTCAGCTGATTTTGATCCAAATCTCGGTGGGATGGATG
ACTTGTCTCCTGATGATTTACCCGAGACTGCTCTACGTGTAAGTCGGTCATCAATTGAAGCACTAACGTCTCCTCGCTCCATCAGACCAAGTGCGTTGTC
GCCAAAGGCACCGAGACGTTTCAGCTTGGGAATGGAACCTTTGTTtGAACCATTGCTACAACCACCTATGGGTACTCAACGGCTCCAAGGAGAGAGCTCT
TCCACAGAAAAGAaGACGAACctGCTCCGTCCAACCCGGCTCATGTCAGGCTCCACGGCAACAATAGCAGACGAAAATCCATCCGAGTGTTGTTTACCAG
AGCTACAGAAGAGGAGATTACAGGATGCATTGGCTGGAGATGTCATGCTGGACATGGAAGGTGCCTCATCAGACGAAGAAAACATGGATGAAAGTGATGC
GAGTGATGAGAGAGTGATCGATGAAGCTGACGATGAGGAGATCGAGAGGAGACAGAACGTACTACGTTCTCGTTCGAACGCCGCTAATCAATCTGCTGTG
TCTATCGATGTCCAAGATACACCTCGGTTTCTCAAGATCGCCCCCATGAACATCCCTAAGTCTTATGACTTCATGATTCTGTACAACAGCGCGCTTTACC
AACGATGGCCTCGGATCATCCTTGTtTTtGTTCTCGCCTTTcTTGTGATCAACGCTGTGTTCGCACTTCTGTATTGGTTTCGCATGTCCGAGATCGTCGC
GTATTCCGATATAGTTCTATCGAAGTACGAGCTTTCGTTTTTCATGAGTGTGCACACGCTCGCGACTATTGGATACGGATCAATTGCCCCCAGTCCGACT
TCAGTCTACATGAACTTATGGGTACTCGTTGAGGCATCACTCGGtATTATTGTCACCACTATCATCACCGGGATCGCATGGTCGAAaTTTGCTCGACCAC
GAGCGCATATCCACTTTTCATCACGGATCGTGATAACAAATATCTATGGACATCGCTGCTTGGTATTTCGAGCTGCgAaTaCACGACACAGCGGTGATGT
CCATGAGAATTTCTTCCGTATTGGAGTGATTCTGACCAACCGCAAGACTGGACTGCGCCAACTGTACGACGTACCTCTAGTGACAGCTGAGTGGCCAACC
ATCAAGCTCCCGGCGACACTGATTCACATCATTGACAAATCATCCCCATTCTTCAAGTtcAAGTCAATGGAAAATCTGCTCGAGTCTCGAGTGTCAGTGA
TTGCGTTGCTCACGGgTCTGGATACAACTTTTTCCGAGAATGTGTACGCACGGAAGATGTACTTCTGGGATGATTTTGCGTGGAACAAACGCTTTGCAGA
CTTCGCTGTTTTACAGCgTGATCGTGTTGAGGTCGATTTCGATAAGTTTGATCAGCT