Description :
From Genome Similarity Track
Location :
Scaffold_48:148162- 150207
Sequence
2045 bases(100 bases per row)
GTGTACTCCATCGTATAATGCGGGGAGTACCTCAGTGAGCCAGTTGCTTGTTAAAACCCAACTGATGACGTTGTTTTGCCGTGCTGTTTGGTCTCGGGCA
AAAAGCTAAATGCTGCGAAGACGAGCCGGCAGGTTACAGCCTTGGCCTTCACTGTGAAACACTGGTGTGGGTTATTGGCAATGGATATATCCAATTATTC
CGAGCTTGATCGACACCGGCTCTAGCAAGACTTTGGTTGACGCCTAGCCCCTGCAAAAGTGCGTGCTTTAGTCTCTCGGCGGTTTAAGACTCGCTTTCGA
CTTCCGCAAGGCCAAATGACTGCGCTAGGGAAAAAGCGTTGGAGCTGCAACTGGCCGAATTCAATGAATATCGGTGGGTAAAATGGACCCCTTTGGTGGC
AGAGCTGCTACCTTACAAGTTGATAGTCGGCCGTGACATTTTCGAAACCTCAGATATGTGCTGGACTAAAAGCACGGTATGATCGCTTGGGATAGCACCG
TAACGACGCTACAGGTGTTATAACCCCCTCAAACCTGGCTGCCGGCTTCCAGCACCAGCCTTAACAGCGGCAGTTAAACATCAAAGCAGCTGACTACAAG
AAGGCGCCTTCGGACGACTATATTCCGAATAGGCTGTCGGCGGCCAAGCGGGCAGACCTAATTGCCTTTCTGTGTCAATAGGAAGACACGGGAAACTAGG
CTCGCGGGAGAGGAGCCTTACGACATCCCCACGGTGGAACAACTGAACACTTTCACTCAAAGCCTGACCCAATCCCGCACAATCTGCTCCAGCCTACTAA
GAATGCGATCCGTCGTCTAGAAGAGCTCACGATCAGCATACGAGATTCGAAAAGCCCGTGGGCATCGCCAGCCCTTTAATACCCACGAAGGATCAGACGC
CGCGGCCCCTGTGCAACAGTCGCCAATTAAACAAGCGTCTGTGTCGGCAAAAAATCATCGGTTTTTCTCCGCAACCTCCTTCGCTTCACGGTGTTCACGG
TGTTCACGGTAACTGATCTCAATATGGGCTACTATGCGATCCGTTTGACGTACCGATCGTCACTACTGTCAGCTTCATCCTACGATTTGGTAAGTACCGC
AGGCTTCGGCAACTCATGGAAATCTCGACCGCCCCCGATGAATTTCAGGCTTGAATTGACCAACGCCTGGCTGATAGAGCTGTCGACGTCTGGCGTATTA
CACCTCGACGTCCAGAAATGCAAACGACGTAAAAAAAAATGCACCCCTTCGACACCCACTTATGAGTCACCTTTTCGAATTAAGGTGCTGCTGTTCATGG
AGACCAACCTCACCAAATGTGGCGTTGTTGTTCATGCTCCATGGCCGTTTGAAGCTTCCAATCCATCTATTGATGCAAGCCCTCGGAGAACGTCCGATGT
GCACGTCGCACAACAGCAAGCAGGGATTGGCAGAATCTGCAATGGCCAGACATCAAATACTGCTCCGCGCTGGTTTCGTGCACACGAGTGCTTCCTGTCA
TTTGGTCGGAACAGGTGCACAATTTTGGCGCCAAATCATTCTGGCTGTACTTAATTGGCGCTGAATGAGTCTAAATGAACGATGCGCTGGGCGTGGAGTA
GATCTTAGTGACTATCCAAGATCCATAAGGATCTTCTTAGAAGTGGGAGTCATGCGCATGGTAAATATGGCAGTTAGCAAGCTGGAAAATGGCAGGGTAT
TACTGGGCCCTCTCACATAGTTTCGACCAATAACACTACGAGAATCGTATGGGTGTCGGCGCGGTGCAACGTGGCATCGAGTGCAAAAGATCAGACGTCC
GGCGTCGATGATGTCGAATCGGTGCCTAGGGTCGTGGCGTCGACAGCTTTACTGGCTGAATTAGAGTTCGTGCACTGTTATCTCTTTATCCTTCTAATCG
TCAAGAAAACGCACTTTACAGCTCTACTGGCTGAGCTAGAGCTCGTGCACTGTTATCTTATTATCCTTCTTATCGTCAAGAAAACGCACTTTACAGACCT
TCTTCTGCGCCTCAACGTCGTTTCACACGGATGCGCGACGCAGGA