Description :
From Genome Similarity Track
Location :
Scaffold_1217:1481- 2624
Transcript NameFunction/comments
Phyta_totarag12427hypothetical protein

Sequence
1143 bases(100 bases per row)
AATGGTTGGTTGGTAGGCATCGTGACTCAGCGCTCGGCTGATCTAGACTTACTTCTTCTAAATCTACGTATTACTCTAAACGGGCGTTTTTACATGGTCG
TCGAACAGGTTTTGAGCCCAGTTAACGCGGAGAACGTCTCCGACGCCAGGCACGGCCAGGCTTCGCCGCCTAGAAGAGGATCGCTGGGTCAAGAGAGGGC
CTCGAGCAAGCAAGATGAGGAAGTCAACTCCGCCGACGGCTCAGGAAGAAGGGAAACGACGGTAGGAGAGCAGGAAACGCTGATGGGCTTGCTGCGCGGG
ATCTCAGACCGCCTGACGCGACTTGAGGAGTAGCAGGCGGCACTCACTGAGGGTGACGGAACGAGAGGCGTGGAGCAGATGAGTGTCTTCGACTCGTCAG
TTGGGCTGGGATCGCGTATGCGGCTGGTATCTCTGGAGAGGACGCCGCAGAGGACGCCGTCTCCACTGGGACAAGGCCGCCTTCCACACTCGTACTTTGT
AGCACACCAGCCTGGGTACCAAGGCATTGCTGCGGAGGGCCACCGAGCTTTCGAGCATCGCCCGCAGCACCAAGTgcctcaacagcagcagtatgtAGGG
CCGCCGCCAGCTATGCATCAAGCTGCCCCTCCCGTGTACCAGCAACAACCGCAGCATACTGAGCCTCGCACACCAAACGCAAGACAGTGCAAACTCTCCA
TCCGAGTGTTCAACGGGAAGGAATTGTACCGTAGGCTCGGCTCAGGATTTAAGGGCTGGGGTAAACGTTTTGTTCGTCAAGTGACGATCGCAGAGGCTGC
GTGTGGGTTTTCTTGGCCAGAGGCAGTTAAAGTGGACTTGCTTGGGCATTATCTCGGTGGCACAGCGGAGCGATATTTCCATAGGCAGGTGGACGCCTGG
TGGGACGAAAACCCTGCGCTCTGGTAcatcatggagaagatgctgtggACCTTCAGCACTACGATCACTACGACGTAGTCGATGCGTCTATTCACCAGCC
GCAAAAGCACCAAGCGAAGCTGGCCCGAGCACTATCTGTATCTGGTTGCAGTTAGTGAGGCGATTGGAGGTAGTGCAGACTcacttgtcttggacaaTAT
GCGTCGGAAGAGTTGAGGACCATTCTGATGACCAAGTACAACC