Description :
From Genome Similarity Track
Location :
Scaffold_229:14808- 16182
Transcript NameFunction/comments
Phyke_g8275hypothetical protein PHYSODRAFT_481160

Sequence
1374 bases(100 bases per row)
ATTTTTAGACTGGTGTAGGGGGAGCACCATGGAATAGACTAACTTAGACATCCATGCGATATGTCAGGTATAGTCTCATTTAAGTACGAAAAAAACCATA
TTTAGCGTCACTGGTTGAAGTGCGCAATGGACCTGTCCGTATTgtgatgaagcagcagcctgcAAGGCCGCCGCACGGCGGTACGGCGAGGTCTTCACCT
CTGACTGCACGCACACGACGGAAAGAATCGTCCACTTTCGCACGTGCAGATCTATGGAGCTGGACAGAAGATAACGCCAAGGACGAGCTCATCGACAGTA
TGTTACGGGAGTGTGTCCCTCCTGTAGCGTCTCCTGCAACACCTTCAGCAACTGTAGGAGGAGCCAATCGCTCCTTACTTCCATCTCGTCTACGTCTACA
AACTGCAGGACAACATCCTCATCTACAGCCtttacaaactcctagtCAATCCAAGAGACTGCCCCAACGGAACCAGTCCCCTCCACTACAGCCACAGACT
CAACCTGCTTCTCTAAAGAACTTAATGTCAGTATTAACcccagcttcagcagcttccactgGATCGGATGCCTGGAAAGCCTTTAAAGTTGCACATCGTA
CGAATAAAATCCTAGCCAAAACACGGAAAGCTATTAACATTTTAACAGGTCAAGGCGCGAGGGGCTTCacggatgaagacgatgcaaATTCCAGCCAAAC
TGATTTGGATGAGGCAATGGAGCAAGAGGATGGCAAGCCAGGAGAGACAGATGAGGAGCGtctgaatgctgctgcggctgcaaaGTTGTTGGAGGCAAAG
ACGATGTTCCAGCGagaagtgctggatgaagatgcttcTGATCGTGTTAGTCCGTCTGGCAATTTCGGTAACGTTGAAAGTGGAGCTGAAGACTTCTGGA
AACTCTATAAGAACAACACGACCTGTGAACGACCAGATTCGGCGCGGGGACGATATATCGCCAACTGCCAGGATTCGtctttgctggtgctacCTGTGCT
GGATCTTAAACGTCCGTCGCGATATGAACGCGGGACTCAGGTACTGCGTTACGATAATTATTACTTCGGCGATAAGCGTGCAGAAGCGTTAGGTGAggcg
cttcagcttcttcctgtgCCTGTACAGACTTTATCGATGAAGAACGTGGGCGTGTCTGGTAGTGGATCATCCGCCATCATGAACGGCATGCCTATTCGCC
AACTAAAGCACTTGGACTTCTCAGAAAACCGACTTGGTACTAAGGGAGCTCTCACAATTTTTCGGACACTGGAAAACCCACAAGTGAATCTCACGACATT
AGATCTTGGCAACAACCAACTAGGAGACCAAGCGGTGAGGTTATTGGTCCAGTGCCTGTTGAATCGCTGCACAC