Description :
From Genome Similarity Track
Location :
Scaffold_161:14807- 19725
Sequence
4918 bases(100 bases per row)
GACGTCGACATGGAACCAGTCAGCTCGGACGAATACGACCCTGGTGACCTAAATCTGGAGGTTACTCCGGCGAGGATGGCCAATGCAACGATGGGACAGG
GACTCAACGTGATCCCTCACATCAAGCTCTCAGAGACTTCGGATCTCAAAGAGTTCCGTGGTAGATATCTGGACGAAGACCGGGCACGCAGTTGGGTGAC
CACGGTGAAGACGACGTTCGCAAGGGACCATGCGAAAAGTGTCTTGTCTTCGGAGGAATGTTGATCGTACCAGCGCAGAACTGGTATCGTCAATTGGGTC
GCCCCGTTCGTGGAAATTGAAAGGACCTGCTACAAAAATTCCAGATGCAGTTCTGTGGTCTGCCGGTACCAGTTGCTCGCCAGTACTACCACGCGAAGAA
GAGGTCAGATCACGATTAGACTATCTGTACCGCCTGAACGTGATTGCTCTCACGGCGAAGTTGAAGATCAAGAATGGATCACCAAGATTCAGAGGGAACA
TGTCGAGCATTAAATCAAGGCCGTGGACAACCCAGAGTTGACAGAGCAATTGATGATGCTACGTCTGGCAGATGTGAAAGAATTGAAGGAAGTATTGAAG
GCACTTCAGAAGTCGAAAGCACGGCGTGGCAATACGCGGTTTGGTTCTAGCAAGTTCCGTCAGAAATTGCCAGCTCTTCCTGATCTACCTAGAGATGTAA
ACCATCGTTCTGAACATGCGGTCCGAGCGCCCTATAAGATCCAAGTTCGGAGGGATTTAGCCTGGATAATTCGGATAACGAGGGAGACCTGAGACGGATC
TACCTAGCGGAAGCGGAAAGAGACCAAAATACAAGAACCATGAGGGACAGACTCGCCAGAGAGGTCAACCAACATCGGAAACAAGCAGAAGACCCTGGAA
CCCGCAATACGTCGGCTGAGTCAAAACCATGAGATGTGCCTACTGCGGGTCCAGAAAATATGGAGATTTGAGATGCAGGAAGAGAATAACCTGTGACCGC
TGCGGGGAGAAAATGCACCCATCGGACCGCTGCTTGTTTGTGTGTCGGGGATGCGGAGCGACCCATGAAGCGGGGAAATGCCAGCTAGAGGAATTCTACA
ATTTGATTCGTCAATAGTACAAACCCACCAAGAACGCCGGAATGTTGCCGGAGAAAGATTAGAAGATGATAAATTAGAACGATCGCCAGGTTTGAATTTG
GTTCGAGTCGAGCGTTCTAGTTTTTTTATCTTTGCATATGTGGAAAAAGAGCCCAAGGAGGAGAGGGGGTTTTCCACTAAGAAGATCGATAATATATCGA
AGATAGGAAAGTACTATATGGTCCATGTTGTCTCTCTTGATGAATCTAATGATTTCACCCGAGAAAATGCAGTAATGGAGCTAGACCTATTGCCTGGAGA
TTCCAGAGGGAACTGGAAATGCCATGCCACAACTAAGTGGTTTAAACAAGCCAAAGCTTTTGGGTAGATCAACAACGATCGCGCAAATTTGTTGTTCGAT
ACTGGCGCCGAGATATCCATTTTGGATGTCGCCTTTGCTCGTAAGGTAGGCTGATATATTGACGAAAGCTAACGACAAGAGTGCATTGGCATTGGGGAAT
TGGTGTACTCTACGGAAGGGCGCACTCGCATCAAGGTCACCTTAAATGGCAATTTAGTGTACGTTTTTAAGGTGTGGACAGGCCCTATGGTGGGTCAGGA
TGCGATATTAGAATTGGTCTTTATGGTCCCGGCTGGATTCCAGCTCCATCTGGCGGATGGAGCACTCTGACTTCCCAAAGAAGTCCGGAAAAAACTCTCC
GGACCGGGGACCGTTTACGATAACCGAGTATCAGAAGTGAAGTTCGGACAACATGCCCGTATAATTGCTGGTGGATGTGTGGAGGTACCCCTTACAAGGT
CGATATTAGATCCATGGAGAACATGAGTCACAAGAGGAGAGCGATGGTTTAAAACTATGACCCGGGGAATAGGAAGTCGACAATTGCTGAAGGTGAACAA
CTTCAGTCCCCACACGTTGACATTACATGACGATACCAAGATGGGTATGTGGCTGACGAAGGATAAAGTACCAAGAGCACAAGGTTTCGTCTCGGTAGGC
TCTCGAAGGTATGCTGAGTGGCTGAATCTGGCGTACGAAGCCATTACCGACCAGGTCGACCCTCAAGTTGACATCGAGGAGGGAGACGAGGCGCCACTGG
TGGAGACCCTGCAGTATAAGACCCCATCGCGTATTTTCAGCGTTCGACGACCCCAGTCTCAATGATCAACGTGTCCCACCAGCCGCCGCCAGACAGAGGA
GAACAGTTACGCGAAGAAGAGGTGCCTCTACGAGAAGGGACCTCTCAATAACAAAGTGGTCCCAAAGACGATCCACCGGTAGAGATCGTAGTCGATGAAG
AGGAAGCCGAGGCCAACGAATCTCCACGGGGCGATGAACAAATGTGCACGTTCGAGAGTGGAGATCTTTGGGCCGAAGAAATAAACTGAGGATGGGCAAT
CATACCGGAAGTGGACCCCTCTTCGGAGACTATCGGGTTAGAAGATATACAGATCCCTGATCCGGATGGAAACACTCTAGCAGAGCTGGACCGGCTACGC
CAAATCATCTGGAAGAGACGACATCTGTTGATGGGGAAGGGAAATGCCTTACCGCGCCAGCCGCCTTATGGGCTATATGTGACATTGATGTAGGAAATGC
AAAGCCTATCGCGTAACGCGTACGGAAAGTGTCCCCTCAGTTTGAGGAGTAGTTGGCCGATCTGATCAAGGGGCTGTGGTATCTGCAAATATAATACATC
TTTCAAGTCACTCTGGGCCAGCCCAATCGTTATTATTGTGAAGAAAAATGGGGTGGACATCAGGCTATTCATCGACTACAGGTTGGTGAATGACCTGAAT
TAACTTATGATCTACCCCATGCCTCTTATTAATGAATTATTGGAAAACCCGGACAAGGCATTGTGTTATTGCTTGCTGGACATGGCAATGCTTTTTAAGT
AGTTGGTACGGCTGAAAGAGCGAGGCAAATTTTCTGCATTCATCACCCCACTAGGATTGTTTGAATGGATGCGAATGCCATTTGGGCTCAAGAAAGCGTC
CCAAATATATTAGCGACTCTTGGATAACGCTTTATATAGAGTATTACGAATCCATCCAGGAGTAGGGACAGACGGGTCAGAAGATTTATTGAAAATGGGA
GAACCAGATGCGCAGTCGGGTCCCTCAACCCTGGGTCGACAGTCATATAAAGGTGGCATTCTATTCCCCGCTGAATCCTGGGATGTGTTGTTTACAAAAT
TGGAACTACTGTTGGATGAGTGCGACAACTGGAAATTTGTAGATCAGCACAGTCAAGAGTTCGTGAGGATGTCGGAAGGTCGACTACCTGGGGCATCGAG
TGTCTAGTGAAGGAATAGAGGCTCACCCGAAAGACCTCCAATCTCTGGTCGAACTAACCTTGCCAATGACACTAAATGACATGCAATCTTTTCTGGGAAG
ATTGTACTACCACAGCAGGTTTATTGAAGACTACGCCGTGTATGCGTCTATTCTTTACGAACAAAGAGAGGCTGATTTCATGCGCGGCGAAGCCAGTTGA
GGTAGGAAGACAATACTACTACCAAGGACGAAAACGAAGAAAGGTGGGCCCGCGTTCATTTAGCCTTCGCTATGCTTGAGAATAAGATTGCCACGGCACT
AATTCTGAGACACTACCAGAGAAGCCACTACTATTGTTAATGGATGTGAATTGGCCATTTAGGCGTCACTATTACAACATCACGAAGGACTACTTATGCC
GGTGACTTTTACAAACCGGACACTTAAGGCTAATGAACTTAATTACAGCACCGTGGAAACAGAAGTACCAGTTTCGTTGCGTATATTGAAGATCTTTTTT
ACCATGTTGGTCAACCTTCCCCTCAAAGTCTTGACGAGACATTCGACATTGGTATGGGTTAGAAAACTCTGCCGGTTTGCAGGGGCGGTTGGGAAATTGG
TCCGCTCTCTCATCGTAGTGGACTTCGAAAATCGTGAAGGTAAAAAAGGCGAAGACAAGTGCTGGGGGAGCTGGCATACAGTGTTACACCTCGAGAAAGT
GTAGAGACAATTCTGTCGGCTATTGCTCCTAAGAAGCAGGCAACGATAACGATTGACCTACCTACTTCCACCGTTGAACCGGACGAAGAGCTATATGTAA
TTAGTTTTGGTGGGTCGTCCCGTGTAAAATAAGGAGGTGGGGCTTGATGCGCTATTTTATGGAGACTTCCAGCATGGACCATATTCATAGCCGCCTCCAG
GTATCTCGACACGTCTACGGCAAAAATGAGGCGGAATATGAAGGTATGTTGCCGGGCTTTGATTTGCTAAAAACTGTGGCGCAACGGCGATTGATTATCT
GCCGAAAATCCAAGTTAGTTTGCGGCAGATGCGTGGGAAGATTAAGTGTTAAATGAATTCCAGTCGTGGCCCTCCCATGGGATTTTACATGTAAAACAAG
ATTGGAAACAGAGCGCGGACCAGTAGACAAGTACAGCTTTGCACCAGCAGGAGAGGGTCAAGTCAACGCCGAATGAAGAAAGGCCTGGTTTGGAAGCGAT
CAACCGGTTACCGGAACTGCTGGTCCCTATAGACCAGAGCCCCTCTAACTAAATATTTGCGGTGATTCGGTCACGGTTCTGCACTAGGATATCCGAGGAG
ACCATGCAAGAGGAAGTGGTTCAACGACTTCGAGTGGACCGAATATGAATGGCGCAAGATGTAGAGAGCTGGGCGCGAGGTTTGAAAGCGTATTTGAAAG
AAGAATGGGGTGATCTGTCTATGGAATCTGCTAAATCGTGCAGCAAATGGCAGAAGAGTACGATCTAAGCTAAGAAGGATTATTGGCGTACTGCCCCAAC
TCTAGAGTCGAGCGAGAA