Description :
From Genome Similarity Track
Location :
Scaffold_33:148009- 178011
Transcript NameFunction/comments
Phypa_INRA-310PPTG_134863-phosphoinositide-dependent protein kinase
Phypa_INRA-310PPTG_13487Ras-like protein Rab-8A
Phypa_INRA-310PPTG_13488WD domain-containing protein
Phypa_INRA-310PPTG_13489vacuolar protein-sorting-associated protein
Phypa_INRA-310PPTG_13490hypothetical protein
Phypa_INRA-310PPTG_13491phospholipase D, Pi-PXPH-PLD
Phypa_INRA-310PPTG_13492hypothetical protein

Sequence
30002 bases(100 bases per row)
GATTTACCTTTGACTGCACTCATAGCATTGGCTTCCGTGCCTCCTAGTCGGTTCTTGGGATCTTTCTGCAGTAGTTTGCTAATCAAGTCCTTGGCGTCGT
CAGATAGGTAGTCTGGCAAGTAATAGCTGCCATCTTGAACGCGAAGGAATGTGAGGTACGCGCTCCCACCACTAAATGGCGTCTCTCCTGTCAAAAGCTG
ATAGACAATGCAGCCGAATGCCCACATGTCACTAGCATAGGTAGGTTCTTTGTTGTCAATTGTCTCCGGGGGCATATACTCTGGCGTGCCGACGAAATTC
GGTCCGTTGAGCTTGGAGTCAGCCAGGTTCTTGGCCGTACCAAAGTCAATGAGTTTCAGGTGGCCGCCTGTATTCTTGCAGACCACCATGTTTTCCGGCT
TCAAGTCACGATGTAGCATCTGGTTCGCGTGCATGTACTCGACGGCGCTCGCGACGTCAGCCAAGTAGAATCGTGCGAGATCCTCGTCCAGCCCGAGCTG
CCGGCCTTCGTGCAGTAGGTGGCTGAGTAGCTCTCCACCGTCAAGCAGCTCCAGCAGGAAATACAAATTATTATCATCTTGGAAAGTCTGATAGAGGCGA
ATGATGTTCGGGTGGCGAAGACGGTTGAGCACGTCCTTCTCCATGTTAATCTCGTTGAAGATGTTCTGGTGGCGAAGACGCAACCGTTTGATGCGCTGTT
TCTCAATCACTTTCAGAGCAAACTTTTCTCCTGTCGCTATGTGCGTGACTTCCAATATACGGGAGAAGTTTCCTTCGCCTAGAGGTCTGCCTTGCGCGAA
CTCTTCGATACTGGGCTTATCGGTCGCGTCCTTCGCTGTGGTGATTCAGCAGCGCAACGACAGTGGTCAGATCATGTATATTTTACAGTGTTGATCGAAA
ATGCAAGATGTGGACATTGAACATCAGTGGATGACCCATGAACGTACGGCTAATTGCCATGGTTGCGTCGTCTCGGTGCGAGTTTGTTTTGGATTAAGAT
CGTTTTCTGAAATTTTCATCCCTGTTTTCACAATATTACATCTATGAATATGGAATTTCATTTATGGAATACATTATTACTGTTAATATTGGTAAATACG
ATTTTTATTTCGTCAAACTCCAATAGAAATATTAGTAATATTAAAGTTAGTTTTATTGTTGCCTTTTTCGATTGCATAATTTATTAACGCAAATGTTGCC
TAATTTTTTGTTGTCTCTTCGGGAAAAAAAATATCACAAAAATATTTCCGTATTTGCAATGTGTGCGCTTATGTTGCATTTGGTGTTTGCAACACTAAAT
TCGGTGTCTACTAATAGAACCCCTTTTATATGCGTTACGAAGGCTGCGGGGGGAGACGGAAAATAACTCAACAACCGACGAGCGCAGTGAGAGAACGCCG
AGCCGCCGCCTTGCCATCTCAAGCCTCTATCTCTCGCCAGGAAGCAGTCGCCTATCCCAAAGCCTACGTGTGTGCAGGTACAGCGTGCATTCTAGCTGTT
CTTTCGTTGCATGTCCTCTTGCTGCTACAGCAGCAACAGTGGATACCTTTTTCTCTCTGTCGACGATTCGTCCGGACACTTTAATTCCGCCCTCTTTTGC
GCCGTCCCGTGTGCAGTTTTCGCTGTTTGACGCGCACATTGAGATAATTTAAGTGGTTGGGCGGACCGTAGGCGGTCGCAGAGGGAGAAATATTGCTTAC
ATCACGGCTGTACTGACTGGTACTGTGTTATTTTTTTCTGTTGGGTAACGCTGGCAGAGTTGTAACTCTTCAACAGAATGGCTCGTCATGAGAACCCTTT
CGATATGCAGATCAAACTGCTGATGATCGGTGACAGCGGTGCGTGCAGAAATAAGAGATGAAAGACGATGTTTTTTTTGAGACGGTGGAATATTGACAGT
CGTTGTTCGACTGATGATACAGGTGTGGGGAAGACGTGCTTGCTGCTGCGCTACGCCAATGACTCGTTCTCTCCGACATTTATCACGACCATCGGCATCG
ACTTCAAGATCAAGAACATAGAGCTGGACAACAAGAAGGTGAAGTTGCAGATCTGGGACACAGCTGGCCAGGAACGCTTCCGCACCATTACGACGTCATA
TTTCCGCGGCGCGCAGGGTATTTTATTGGTGTATGACGTCACTGACCGTGCATCCTTCCAGAGCATCCGTAACTGGGTGGGTCAGATCCAACAGCACGCC
GACGTGCATGTCAACAAAATCCTCATTGGCAACAAGTGCGATATGACCGACGACAAGGTCGTAAGCACTGAAGAGGGTCAGGCATTAGCGGACGAGTACG
GAGTCAAGTTCTTCGAGACGAGTGCGAAGAACAATATCAACGTGGAAGGCGGCTTCATCGAGATCGCGCGTGAAGTGAAGAACAGGCTCATGGAAGAGGG
CGGACCGCACAAGAAGGACAGCGTCAACCTCAACGCAAAACCGGCACCTGTGAAGAAGGGCTGTTGCTAAGCCTTTCAGTCAGTTTGCTTGGGTTTGGTG
GCGTCGCAGCTTGATAACGCTCGCTCGCTGCTCCTCCACGTATGCATCCTGCCTTACTATAGCTAAAACTTCTACTCAACTACTCTTTTTTCATCGGTTA
TGTCGATCATCATGCTTAGTATCACTTCCTGCTCAAATATTGAATGTTTGTCTAGCTCTAGTCAGTCTCGCGTTCCCACACGTGTACTGAATTGTCAAGC
GATGCAGTAAGAACTACTTCACCATCGTAACTAAAAGTGCAGTCGAAGACCTCAGCATCGTGACCACGTAGTATTTGTAGACATTCCCCAGAGAAAGCAT
TCCACACACGAGCTGTCCCGTCGGTACTTGCCGTGAGAATTTGAAGTCCTTGCATACTAAAGCAGACCGTGTTTACAACCTTCTGATGACCAGATAACAC
GCATCGTCTAGTACCCGTTAGAGTATCATATATGAAAGCGTTGCCATCAGTACCACAGGACACAACTAGTGCTCCTGATGCATTGAATGTAGCGTGGGTT
ACTTCATGACCTTGATGATCATCCCAGTCATAGAGATTTTCCCCTGTCCGTGCATCCCACAACTTACACGTACCATCGGAAGATGACGATAATAAAGTGT
TGGCTTGGTAGTCAAAAGATACGCTGGATATGTCAGCGTCGTGGTGCTCAATACAACGAAAGCAACCGCCAACGCGGGTGTCCCAAAGTCTCACGGTGGA
GTCACAGGAACCTGTGGCAATGAGCTTGGTATCTTCAGAATCAAATGCTAAGCATGATACTTCGGCAGAATGACCCGACAACGTTAGCCGAGATTTTTCC
GTGGCGGTGTCCCAAACAACAGCAGTGCCATCAACCGAATAGCTACCGAAGCATTCACTGCTGCTGGATTCCGGTGCATACACAGCACCCACGACCTCGC
CTGCATGACCTCGATACACTCCAATTGCCGTTTTTGTTTGTACATCCCATAGCCGACAAGTCTTGTCGAATGATCCAGATAGCAATCGCGTGGCATGAGG
TTTGTTGAAAGCTAAGCTAAACACCACTCCGTCGTGACCTGTTAACGTAGAAACTTCTTTATCGCAGTTTTTATTGTGGAAAGACGACGTCGCTAACGGA
ATTGACGGATCAAATGGCCGCAGTAACCGGATGGTCTTGTCGTAGCTACTAGTAGCTACTAGATTGGCGCTCTTGCTGCAGGCCATGTTGGTCATCGGAA
GATGATGAGGTCGTAGCACAGAATGCAGTCGGAATGCACTGCCTTGTTGGTGGCTTGCATACACAAGGTGCTTGTCCACGAGTCGGTGAAGTAGCTCCTT
AATCTTCGACAGTGTAGCCTTCGTGAGCAATCGCTCTTGAACCACAAGTTGCTGAGCCACCAGTGAAATGTTGGATTCAGCACTGAGGTGGGGCAAGTCG
ATGGTCTTGAGATCCGTCTGGCCATTGGAGTGGACATATTCCAAACGCAATGCTGGTGGGTAGTACCGCAGATACAAACGGCGGAGATGCATGGACTACA
GCAGCTCATAAGCGTCAGTACTTCTGCGTGGCCGACGAGTCGTTGAAACGGAAGAGGCGTAAATAGTAATTTCTAACAGGAAATCTTAACAGCTTCAACT
TGGAAGTCAAGTATAAAAAAACCATTTATTTAGTCAGTCATTCAGCGCGGCGTCGAACACTATGCATGGTAGCTTTCAGAACGAGCAGGACGGTGAGAAT
CGCTGTCAGCACCACAAGCAGCCCATCGCAACCTAGGTTCAAGGGTTGGGTAGCACAATCTACGGTGCTAATTGTGAATGGCAATTGCTGAGCTGGAGGC
GCGAACGATTTTGACGCACCCCACCAGCCCTCCTCGATCATGTGCTGCTCTTCGTCTTTATCACATGTCTGCTTGATAATTTCTTGGACTCCACAACTCG
AACCTCGGACTCGCTGATATTCACGAATGATCCATTCCACAGGCAGGTCACGAGCATCGATGGGAGTCGCCCATGACAGGTCAGGGATATTCAGCGTAGC
AAAAATGCAAGTACTCTTTGAAAATAGCGCTCAATGAAAAGGTACCCTCTCGAAAGCGATATGGGCAATGACTTCTCCGTCATTGCCCATATCGCTTTCG
AGAGGGTATAGCTTGCGAGCTGATTGGCTAGGATGGCATTCAGACGAAAAAAACCCATTAAAATTTTAATGGCTTATTTTCGTCTGAATGCCATCCAAGC
ATATTTTATTACGATTGATTACTCTCTCTGAGAGACCTCTCAGAACGTATACATTATATAATATTTCAAAATTCAATTGAATCCAGCATTCGACTTGCCC
CCCCTACGTAGCATGAGCGAGGCGTCATCTTCTCCGCGCTCCGTGACCTCCAGTGCGCCCACATCCGCCCCTGGGCATCGAAGCAGCAAGAACCATGGAC
ACCAGACATTCGCGAACATCTCTGCGATGGATCTACTGCAAAGTATGCGCTCACAGTGTTAATATTCCGTCTCAAAAACCAGCAATAACCTCGTCTCATT
TTCTTTCCAGCATTGCCGCTGACCGCCGCCGGGCGTCCCGCGCTCTTCGGCAACGAGGTGGAGATCTACAGCGAGGAGCACATCGGTCTGTACGACCGCA
CCTTCAAGACACCGCACGTGCACGGCCGCTGCTCGGTCACCACACACCGCCTCTTCTATATGGACGAGACGAGTTCTCCACCCGTGGCGTACTTTGTGCC
GCTCGAGTGGGTCACGCGAATTACGAAGGAAGCGGGCTTCCTGCAACGCTCCGCTAAGGTGCGGGTGGACTTGACAACGCGCCCACAACCACAAGCCACA
TCGTTTTTAAAGTTATCCTTCAAGGACGGTGGACGTGACGACTTTTTCAGTCCTCTGGAAGCCTCACTAAAGCGGAAAGCTTGGAAAGACACGCAACCAA
GTCACTTGGCCGATAGGCGACTAGTAAAACGGCAATTCAATGCTGCAGATGCTGGTATCGCGGGTATTATGCGTCGCCAACAGGAGGCACAGAAGGAGAC
GACGGAACTGGCGGCCACGGCGTTCACCGATTTGGCCAACCTAATGCTTAAGGCTAGAGATATGGTAAGTCTGATTGAGCGATATGTGGACACACAGAAA
GCCGTGGAATCGAATGGAGAGGATGGGACTACGACGTCAAGGGAGGACGATATCAACAAGCTCAGTTCGTTGATGCTGGATATGGGTATCACCAGTCCGG
TGACGCGTGAGAATTCAGGTGCGGCGTATTACGAACAGCTTGCTCGACAACTTGCGGAGTATCTTAGCGAACATATGCCGACGAATGGAGGGATCATGAC
CTTGTCGGACATCTACTGTATGTTCAATCGAGCACGAGGCGTTGAGCTGGTATCTCCGGACGATCTGTACCACGCAGCACTGTTGCAGAAAAAACTGAAG
CTTGGATATAGCGTGCGCAAGTTCCCTGGTGGCCTCATTGTACTGCAAACAGACTCGCATCGTGAGGATAAGGTGGCTGAGCGTCTCGCTAAGATGGCAC
AGAAGTCCAGCTCCGGCTACATCACATCTACCGACGTGTCGGTGGAGCTGCATACGTCATTCCCGTTAGCCTGGGAATACCTAAAGGTATGTAGAACAGT
AGAAAATGATGTGGCGCTCTGTTGGGACTGACACTATGTGCTTTTTTTTACAGGTAGCAGAGGAGCTTGGAAAACTCTGTCGAGACGAAACATTTGAAGG
GACCAACTTCTATCCGAACAAATTTGAACAACTTATGCAAGATGCGGAGGTGGAGAAGACGGCGTAAGACTTTTTGTGGGGATAGTATGTGAATAGAGGC
TTGCTAGGTAAGACATATGAAAGATAGACGCGGCCAAGTATGCTGACCCAATTGCTGAAACTTAGAGCGTTCTGTTGCTGTTTGTGTGGGTCTTGTTTGT
CAATGTCCAGCCTGGTTCTCGTGCTTTACAGGTTTAGTTGCTCGTTGTCTGTGGATGTATCTCACAGTCTTCAACACACCGCCCGCCTGAAATTCCGAGC
TCCTCGATAAGGCAGGCTCCGCCACTTTAACCATTCTAGATACACAAACGAGTTCTTCTTCCTCGTCGCTTTGCTGTCCGTTGTTGTCTTCTTCTTGGTT
GTTCGAGCCTGTGGAGTGTCCAGAACTTTGCAACTGCCGATCAAGCACTTCCAGCATTCTCGATTCGGATAGCTGATCATGAAGTCGTCGTTGGAACACC
TTTTTCCGCCTTGGATTCTTTGCGGCGAAAGCTGCATCACACTCGTCTGACTCGGGATTCATCGCTGAAGCTTCCTGTGTGTGCTTGCGTTATACGTTGG
AATGGCAGCTAAAATAGAGGTGAATCAGCGGACTTCCAAGTTCTGGCGTGATAAGAATACTGGAACGCACCCGAATGCAACAACGAAGAATTTGCACATG
TACGTTAGCTGTCCTCCTAGGAATGGTTGGGTATTGAGCGTGAACACCAGCAAGGAGTCTTAAATGCGTTTCATCAACTCTTTAACGGATTGTCGCGCTT
TACAGTGATGCTGTCAATGAAGGACACAAGCGTGGCTGTACGGACCTCAAGTACCATCGACAAGAGTTTAAATCTACTGCAAACAAGTTTGAAGCAACTA
AGTACTACTAGTAGTATTAAGCTGTGCCAAAATGTCCCTACAGCAAGTAGTATTTGTTGCTCGCCTAGGCGGTAATTCTAGCTGCAAGCATAGAAGTTTA
TCGACTCCAGTTTAAAAACGTCGCGCTTCGATGACCTTGGCCACAATTTTTCTCGAAGTGCCCCATATCGGTTTTTGGTTAACGGCCGCGGAAACTGCAC
TGGCAGGCGGATTTAGCACGACGACATTTACGGCATTGCTGAATGCGCGGGCGCTTCGGGCTCCTCTCACGTGACCTGCCCTCGCGGCTGTGCCTATCTC
TATCTGAAACACCGTATCCACGGTCTCGACGATCATAGTCACCACCTCGACTGTCACTACGGCTGTAGCGATCGCGTGCATGGTCCCGATCGCGGCCGCG
GTCTCGACCATAGCCGTTGTAGGAGTAGTCGCCACGATTATTATCCCGCGTATCTTCACGCTCATGTTCACGCTTCGCCCGTGTTTCATCGTCGTCCTCC
TTCATCTCGAGACAACGCTTGCAATAACGCGGAGTCGCTCCACCGACGCACATGCCGCGACAACGGCCAAAGTCGGGCTTCTTCATCAAGTCAATATCCT
CAGGACGCGTGTACCATTTCGGTGCTGTTTGAAAGCGTTGTGCTACTCGGTTGCAGATCACTTCCATGTAATCATGAATGGCCTCCTTCGACACGAACTT
TTCATACAACTCATTGGCACGTGCCGCAATCTGTCGGCATTTTTCGTCATTCTCACGACACCACCGAATTTTCTCTGCCAAGTCTGAGAGATCCGCCTTG
ATCGGCACATGATCTTCAAACGGTTTGAGAATCGGGTAGTACCACATCTCGTCGGCAACACAGCGCGACTCGACTTTGAGAATCACACTACCCAGACGCA
TCAAGAAGGCGTAGCGGTTGGCAGCGCAGTGACCTTCAACGTACAAAATATACTTGAACTTGGACTGCTCGTAGATGGGAATGAAATGCTGGCGTCCACC
TTCAAAGATGAATTCCTCGTGACGTAAGAATGTCATAGGCTTGCCAGCAATTTTCTTATCGCGAAGGTTCCACGTCGTAACTTCAGCGTTGAGCAGAGGG
ACCAGCTCTTGGTCTCCACCTGCAGCATCGCTCTCGGTCTTACCGTTCATCGTCGAATCCTTCTTCCACGTGTTCGAGAGGTGAGCCAAATGAAGACGTT
GATTGGTTTCAATTGTTGTGCCGCCACCAGTCGCACTACCACGGAAGAAGGCAGTGTTTACCTTGTCTTCCCAAGGTTTGTAGAACTTCCGAAAGTTGTT
GGCAGTAAACAAGTCACGCGCGCCTTCAATGCCATGTCTCTTCCTGCCGTTGGCGCCAACATCACAGAAACACTCCCAGTCGTTCTCGCAATGGACCGAG
TTACGACACGGACACTGGTCGCAATGAGTATGTCTGAATGACTGCGGGAACACAAGACCTGTAGCTGCCTCCCAGTCCTCTGAACATGGGAACGGGATAT
CCGCGAAGCGCTTCGACACGTAGAAGCTCATGATCGGCGCATACGTAGAGTAGCGGTGCTCTGTGAGTGGAATATCTTCGTCGGGATTGCGGTCGTTTTT
ATCAAACAGGAATCCGTACGGCTCGCTCAAGTTTTCCTGTTAATTCATTGATAAAATACAAAAATTAATCCGCGCATTTCTTCACTTTAATCGACATCGG
CTACACACCTTTAAATGCGGGTAGTCGCGTTTGTTGATGAAAAACTCGCAGTCTGGAATGTTGCGGTGCTTGCACGCGTCCTCTAACATGTCTCGCAGCT
GCGTAAGGAACTGGTCTCCCCAATACTGCGTCTCGTCCTCCTTGTTGCGATACCTGCAGTGTTCGTTGCAAATGATGTTGCCATTGGCCCACCACTTCTT
CACGTCTGGAATGATGTTCTCGCGTCGGTAGTAGCGCTGTTTCTCCCGGTAATAGGCGAACATGCTGCCGTCCGAGCTGTCGAAGGTCACGTTCTGCCCC
CAATTGTTCTCGTAGTCCTTGTTTGCAAAAGGTGCGAAGATAACAACGCGTCGGCGACGGATCATTACGAAGATACCACAGCGCATATGGAAGAACAGAT
AGTGCAGGGTATTGTGCGTTGACTCGCGGTTGGTCTGTTGGTGGAAGGGCATATTGACGCGATAGTCGACGTCATTGGCGATGGGAAGCCCCTCGCCCTG
CACGAAGCGGTTGTCGGCGCTGATCTGAGGAGCTGGTTCAAGTGGGAACTTCTGGTCGTACTCCTCGATTTTAGGGATGAGGATTTCTTTTATCTGCTGC
CAGTCCACAAGCATGGAGAAGACGTGCTGCAGCTTGGGGAAGTCCGGATTGGAGCCTCGCCAGCAGTGTTTACGGATGAAGTCCTCGCACTCTGCCTTGG
TGGCGAACTTCGGAACGCCACCCGACGTCTCGGACATGACCACGCGCCGCCATTCCGGAGTTTCTTCGTCCTCGAAGGCGAAAATGCCGCGTAGCATTGG
ACGCTCGTCCATGGTCGCCGCTATTGTGAGGAGGGGGAAACGACACTCATGTACTATTGGATAAAATGGCTGCCAATGAGAAGCAATACTAGGTTTTAGG
AGCCTGAAAATTTGAACCTTAGCAGGATCTTACATGTTAATTTCAGACTGAAATTAGTACTAGGATCACTCATGTTTAGAATCACCTGCAAAGACATTAT
GGCTCGCTATGATAACCAGCGTAACTCACATTGTTGCTGCACCAACCAATATTTCTTGACTCAACGTACGTGACCTCTTCGTATTACGAAGGAAGCAAAC
GATGCTACGGTGCTGGCACCACTGACGGCGGGGGTTATCTAACGCCAACAGTGTAATCAAAGCCGTCTCGTAACCGTAGAGGCGCTTCCGCTTTGGAGAA
AAAAAATCGGATCAAGACTTCCATGCTGTGATGCAAGTGAACAAGAAGAACCCCGAGGCAGGTTTTGCCATCAATGATGGAAATTCCCGGTACGTTTCGT
TTTACAAAAGTCAGATCATTGATCTACGTGTGCTTATCATTGACGTTTTATTGTCCATAGTTGTAGAGCAGTACAAGATGATTCGAGAGCTTGGGATGAT
CCAGTAGCAGCAGCACCATTGATTTAATAAACGGCAATACATTTTTTCAACGTTGCAGGTCCTCCTTGCCGTTGTATTTTGTACTTGCTGCAAATTCCTA
CACAAACTCACCGCCGCATTCAGCAAATTGCAGACTGCAGTGCAACCACTCAATACCCGATACACAGCAGCCATCACTTACGGCAAAGCACCAAAGGCAA
CAAGGTCAGCTGGATATCGGTTGTTTATCGCATGGTTGCGGGTCATTTTACACCCATAGTTGGCGGCCCTTCTCCAGGAAACTCGAACCAGCCAATCACA
GCGCACGCCTTGTGACAGTTTTCCGGAAGCCAGCACCTCAACCGCGTTACTAAACGACCTTCACTTCGAATTAGACCTCCTGGTGTTTGAACGAGTCCTG
CCGTTATGAGCCCCACGGAGCAAGACTCTTCGGCTCCACCCAGCGTCGCCGACGTGGTGACTGCTGCTCAGCATCAGCAACAGCCTCAACAATCACAACA
ACCTCAACAACCGTCACCGGCGCATGCCGGGTCTTCTGTCTTCGACACGACGCGCGGAGCCGGACCCGGCTCCGTTACCGGCGGTCGACCGCGAGTAGAA
TCCTCCGAACACTTTGGTTTCCTGCACCACAACACGGACGAGGATATTTACGTGTTCGAGGAGCCACCCGAGGTTAAAGTGCTCGGTGGTCGCTTTGAGG
AATCCTGGCCCACGCGCTACGTCGAGTATGACGTCGAGGTACGTAGGTTAACTGTATCGTTGGTCCAGTTTTGTATGAGCTAACGTCGACTATTATACAC
AATTACAGTTAAAGTATAAGAACTTCAAGTGGAAGGTGGAGATCCCCAAGTCCTCCATCTCAAGTCTCTGGTTCTACATCAAAAGCCGTCCGCACCTTCG
TCACGCTCCGTCGTCAGTGGAAGTGCGCACTGAGCATGGACTTGGAGAGTCGGGCGTCCCGGATCACACGCCTGCAGCCAATGAGTCTCGGTGGCCGCAG
CTACGTAAACTCTTCTTAACGTCTGCGGACAAGTCCGTTGGCCCCGAGATGGTCGCACTCGTGCAGCAATTACTGGAAACGGTAGTGAAAGTGCCACGGT
TGCTACGGTCTCCATACGTGGCTGCACTATTCCAAGTCAGCAACTCGACGTTTGACGACGAAATGGGCCGAACTTCTGTCCGTGAAGGCTGGTTAAAGAC
ACGCTTCTGGCTGAAAGGTAACCGCGAGAATGTCCGTATCAACCGCGCGTCGGTCTCTTGGGACAACGAGTGCTTCAACTGCATGTGCGTGGTGAAGCGT
GTCAACTTCCGTGCCAAACGTTTGCGTTGGGTGTCGCTCAAGACGTCGAGTATTGCAATTTTTGACTCCATCGAGGACACGATCGCTCGCAAGGCATTCC
TTTTCGACAGTAAATTCAACATCGAACGCGGTCTCGAAACTACAGGCTCCAGTACGACACTTCTAGTCTCGAACGCTACGTATGTTCTTCAGATGGAAGC
AAAGTCCAAGCAGGCTTTGACAAAGTGGGCCAATGATATCCGTCGAGTAGCAGAGGCTTCGAACTGGTCGCAGGCTCATCGTGATGGATCATTTGCGATT
CCTCGCAATCCCGTACACATGACCTCGTTCGCGCAATGGTACGTGGATGGCAGCGATGCGTACGCAGCTATTTATCGCGCTATCCAGTCGGCTACGAAGG
AGATTTTCATTGCCGGGTGGTGGGTTTGTCCGACTATCCATCTCCTGCGTCCTGCGAAACTTTATCCCGAGTCGAGACTTGATCTTGCGCTGCAGAAGAA
GGCAGAAGAGGGGGTACAAGTCTACGTCCTCATGTACAAGGAAGTGTCTGTGGCGCTGACACTGAACAGCATGTTCTCGAAGCAGGTGCTGAGCAAGTTA
CACAAGAATGTTCACGTGTTGCGTGACCCCGACTTTTTGATGAAGCAACTTGGGTTGTGGTCGCATCACGAGAAGATTGTGAGTGTTGATCAGCGCGTTA
GTTTCGTTGGTGGGCTGGATCTCTGCTTTGGACGCTGGGATACTCACGGACACGAGCTATTCGATGAGCCTGGCAAGCCAACAAACTTCGTGGGCAAGGA
TTTCTCCAATCCACGCGTGAAGGACTTCGTTGAAGTCGACCATCCTGATGATGACATGATTGACCGCAATGAAGTGCCACGTATGCCATGGCACGACTGC
CACTGTCGCCTTGAGGGTCAACCAGCTCGCGATGTAGCGCGTCACTTCATACAACGTTGGAATTACTCGGTGTCTACACGCAAGAAATCACGCAAGCTGC
ACCACCTTGTGCCCATGAAAGATTATCCAGTAACAATCACCAACAAGCATGGACCGAAGAAGTTGACTGAGCGGCTTCAGAAGGCTGTACATGCTGTACG
CGCTATGCGTGGCATATCGAGAGGCCGCACAAACACTGACAACCGTGGATTTAACAGTGATCGACGGATGGCGCGGATGTTGAGCGGTCAAAATGAATCG
GGGAATGTGCCTATTCTGCAAGACGATCACGAAGACGTGATGTTGGATCTGCCTGTTGGAGAGGATGAGAATGACGAAGAGTTCGAGAAACACAAACAAG
AAGTGGCTGCTCGAGGATACCGTGTCAACACGCAGATCCTACGCAGCTTGTCGCTGTGGTCAGGAGGTGTGACCACAGAACGCAGTATCCAGAATGCTTA
CATCCGTCTCATTGGATCGGCACAACACTTTGTCTACATTGAGAACCAGTTCTTTGTGTCTGGACTGGAAGGAGATCACGGGGTCTCGAACCGTATCGCT
AATGCACTGGTGGAAAGAATTCGTCGCGCGTCGGATAATAACGAGAAGTTCCGCGTTATTGTGCTGATGCCGCTGCTGCCAGCATTCCCCGGAAAGCCTG
ATGACAAGGACGCCAGTAGTTTGCGAGGTGTGATGCACTGGCAATACCGTACAATCTGTCGCGGCGAGCATTCGATCTACCAGCGTTTGTACCAGGAACT
AGAGGATGATGATCCGTTCAAGTACATCGCCTTCTACGGTCTACGCAACCACAGTGTCCGTGAAGATGCTCAAGCTCGGACTGAGGAGGTGTACATCCAC
AGCAAGGTTATGATTGTGGACGACCGAATTTGTATCATCGGTTCTGCTAATATCAACGAACGCAGTATGTGCGGAGATCGGGACTCGGAGATCGCTGTGC
TGGTGGAAGACCACGAAATGGAAGAGGAGATTGCCATCGCTGACGGCACGTACAATGTGGGCAAGTTCGCGCACTCGTTCCGTATGAAGCTGTTCGAGGA
GCATTTCGGTGTGCAGCCTGGTACGCCGAAGTATCAGAAGTACCAAGACCCGGTGAGCAAGGACGCCTGGTTCTCCATGCAGGAACAGGCCATGACAAAC
CACCAGATCTACGACTCGGTGTTCGGCTGTCTGCCATCCGACAGCGTGACGACCTTCGCGCAGATCGACTCGCATATTCAGTCGGCTCAAGGTCTCGATA
CGTCCGGCCGTGGTGCAGATGAAGCAGTGGCTGCGGCATTGGCTACCGACGCGACGGATGCGACGAGTAATGACGGGGAGGGACGACGAATGTCCTCGAT
GAGCGACCGAGTTATGTCGCCTCAGAACAGTTCGAGAGGAACCAGCACGCGAGGGCGTAAGTCGGTGTTCAGTGGAGCCATGAACGTCAACATGAAGGAG
AGCTCGCACATCGCCCAGCAGAAGCACGAGCTGAGCAACGTGCAGGGCCACATTGTGTACTTCCCTCTCAAGTTCCTGGTGGACGAGCAACTGGAGCCAA
AGTTGTTCCCAGCCGATCTTTTCCAGTAATGAGGATAAGTTTCAGTTTTACTTTTGTTTTTCACTCCGAGTGTGCTATGGAACAAACGATTAAAGATATG
TTGTATCGCTGGTTCCATTTCCAACCATCCAACCAAGATTTCGGTCTACTGCCAAGAGAGCTGTCAACCTGACAGCGCTCGTCATCCTGAACACCTCCAC
GGCACGATGGATTCTCGTGAGCAAAATTTTGATCTATCCTTTGATATTACATAGCCTGTCCGTAGCACATCACATTTAAACCCTGTAATTTTTTCACTTG
ACTTCAGTGTGTATTATATTTGAGCAGCATACGACCCTCATAATTTTTCCACCCACAACACCTAATATCGTACCGTTTCAAAACATTCGGCTGACGTATG
ACGCTCCTCTACACTTGCAGATTCCACTCGAATCGTTCCAGCAAACAAGACGTCACAACCAATTCGCTGGCCCGAGGTGCACACCGCACTCGCACTTATT
CACCGCCTACTAAGTTAACGAGTGCTAACCTCAAGCGCAGCTTTATCCCTGTCTTCACGTACCTACAGCTTCACACTGTCGTTTACTGGCTGCCCGACTG
AATTCCTGTCGCGATGGGCTTGAAAAAGTGGCTGGGCCTCGACTTCTCGGCACCGCAGCCTGTGGGACACAACGCTAAGGGCGACGACGTGGAAGTGGAG
GAGCCGCTGGGCATTGGACGCCGACAGCAGCAACGACCTGAGAGCCACCGCCGCCACACGGCGTGGGAGGCGCAACAAGGACAAAGCCGCACACACGCGT
ACGCACCGACGCGCCAGAGTGCGCCGCTCCAAGGACGCCACACGCTGAGTTCTAACCAACAGCCAGAACGCCGCTTCTCCTCCGACGCTAACGATAACGA
TACCATCTCTACGATGGTCACGGCGATGCAGTCACCGCCACCTCGGTACGATTCGGACTCGGACGTGTCCATCGGAGCCGACGACGACTTTGCGCCATCC
CCAGCGATGCCTACTAGATTGGAGCGATCGAGAACCACGACGGCAGCATCACCTGCGAGCTCGACTCTGCAACGCAACAGTGTCAGCAACGCCTTCCGCT
TTTCGTGGATGAACATTCTTGGTCAGTCAACAAACTCGGAGATGGAACAGAGTGTCATGGCCCAAGTGGCCGAGGAAGATGAAGCTGCCGAAGCTACTGG
GCAAAACACCCGCGCAGTCAGTCAGACCCCTCGCAACACGACGCACAATCCTGACGTGGCATTGCGACCGCAAGACGACGAGATGGGCGTAGTGATGCAG
GGCTGGCTCGAGAAATGTGGTCAGCAATTCAAGACTTGGAACTGGCGCTTCTTCGTGCTACGCAACGATGGCGTCTTGTCTTACTACATGGATGAGACTC
TCAAGAAGCTGAAGGGGTCTATTGACATTGGATATGGCTCCAAGGCAGACGTATCGGTGCAGACCAACTCCATGGATAAAAAGTTTGTCTTTATGATCGC
CACGCCGCAGCGCAACCTCATGATCTCGGCTCCATCCCAGCGTATGATGTCCAAGTGGATCGCTCGACTACATGCAGCCGGCGCAGTGCCTACTGAGCCA
TGGGATCCGCTTCGTAAGACTGTCAAGTTTTACGTGCGCGATACAGAGTGTAATCACGAGTGGAAGCGCTACGACGACCCCACCTCTTACATTCACATGG
AAGGCTGCCTGCTCAAACGTGGCCACGTCAACAAGAACTGGAAGAACCGCTTCTTTCGCATTGAAAAGGGCGAATTGAAGTACTATACCGAGAACCAGAG
CGAGATAAAAGGCTCAATTCCACTGAAAGACACGATCGTTAGTCCCGGTATGGCACAATGCCCTGACGGCCGGAAATACTACTTTGTGTTGACGTCCAAG
GACGGCAAGTTCGAGATGCATCTGAACGCACACAATGAAAACTCGATGCATTTGTGGATCGAGGCGTTGCAAGAAGCTCAGACAGCTTTGGGAAGAATGG
CCGGCAAGAAGGGTACGGTGGCGGGTTTATCCCTTGTGGTTAAACGCGCAGAGGAGATTCCATTGGGCAAAATTGGTGTGCTGTTCAAAACCCCCGAGGA
TATCGACATTGAAATGCAAAAGCGCACAGAGGCTCTGATCGTGGCATCGAGTCCTAGAAACCGCGGAGTCGCAGTGGGTAGTCAGCTAATCTCTGTTGAA
GGCCGCAGTATCCTTCGAGAGACGTACGCAGAGGCTCGTAAGATCCTTCGAGCATCTTCATTCCCGTTGCGACTGGAATTCCTACTACCGCCGTTTAAGC
GTGGTGTTCTGATCAAAAAGTCCCGCTCGGGCTTTGAGAACTGGAAGAGACGTGTGGTTATCGTGACGAATGGTGAGATCCACTACTATAAGCAAGTGTC
CTCGTATAGTGGAGGCAAAAAGGCCCCCGCGGAGCTCAAGCACCGCAAGTCCTTCTCACTCTACGGCTGCTACCTGAATCTGGTGCATATCCCCGGTCGC
GATCTGTGCATTGTGGTGGCGCGTTCACCCTCGGACAAGCTGGTGCTGCAGACGCGCACGGAGGAGGAGCGTATGGAGTGGGCTAGTGTCATCTATTGCA
GTATCCGCATGGTATCGCAGGGCATCACATCTGGCCACATTGAAAACTTGCAACTGGAGCAATCGCGCTTGCCGTCGAAGCACTTGTCCACCGATCTCAA
AGGAAGTTTCAAGGACCACGACCAACTTGAGTTCTAGACATCTTGAAGACTACAGCCATACCGTGGCATGTACATGTGATCATGAAATAAGTGCAAGACG
ATAGCAATGTAATAAATCAAGCGAATTTTTTATTTAAAAGGTTCAACAAAGTATCTTTCGTCATCTTCATCCCGAGATGTTTTCTTCAAGAGGCGCTGAT
ATTTTTCAAGGAATCATTTTTAATAACGAAGGCCAAAATAGATGACACATTCTTAACGGCTGTGCTATTCGAGGAGTAGCCACTTCTTGCCATCCTCCAA
CGACACAATCTTGATTCAAAACCTGAACTTCAGCAGTTTTCCTTTCTTTCCACTTTCGTACACTTCTCTATGATTGGCCAATATTTCTGCCACACAGCGA
TCCTTTTTGAGCCTCCCACACACCCAAAAAGTCGGCGAGACGAAGTGCGATAGAGCGCGTCTGCGTTGCCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGAGCCTTGGGTGTTTCGGGTGAACTCGACACAGGCGGCTTGGGTGTTTCGGGTGA
ACTCGACACAGGCGGCTGGGTCTTTTTTGTTGGTATTTGACTTACTGCAACCGCCTTGCGTTTTTTCTCCGCTATGAGGCCGGATATAATGCTGCTGAGA
TCGTGGCGCTTAATGAACCGAGTTGCCCAGGATCCTTGAGCTGCCGACTCACGTTCACTAAATCCTAGGATTGTCAGGATAGCGTCGGCAATAATATCCC
TTCGGTAAACTTCTTGGCCATTTTCCACCTTCTGCTTCACGCACTTTACGATAGTAGTATCTTAAGAGAGTGTTGGTGGAGCCGTTCCTGAGCGTTTTGT
GCGTTTCGCAGATGGATCAAAGGTTGAGGAGAAGATGTCGTCTTTATTTTCCATTCATCCATGCAATGTCGTGCGCTGAATGCCCAGTTGCCGGGACTTC
TCCGAGGCATCCCAACCCTTCTCCTCGCAATGCAGCAGTGTTTCGATTTTGGGTGATTTCCACCGTCCGTCATTTTGTCAAATTTCGAAATGGCGTATTT
CGGGTAAACTCGACAGATGGTACCTTTTAATTGGTCCAAACCAAACATTGTTTTTTTTACATGGCACGTTTTAATTGGCTAAATACCGTAGTATCAAATC
AGTGGTCGTGTGGTGTTCAACCATTCACCATTTTGAGCAGTGATGGCAATAGAAAATTCTTTCCATAAAAGGTTCAAACGTTTTTGAATTCAAATTCTTT
CAACGAACGTTGAACATTAAAACGAAGCAAAACCCTTTCTAATCGAATAGAAATGCATTGGAGCAACTACAGCAGCAACGCTAATAGTAGCCTCGTTCAG
GTTGATACTTAGAAGAGTTTGCGAATAACTTTCGCACTCTCGCTTTAAGACTAGACAATTGGACCTCGCAGCTTGAAAAGCTCCCAACGGTACTGTTCGT
CTTCATCCTTGGCATCTACACCTGCTCGGGCTAGTGAGCAAGGTGTGTAGGGAACTTGATAAACCGCTGAGGCTGATTGAGCTGAAGGAAGCAAGCGCAG
ATGGAGGATGCACAGGTGATGCTCCAGACGCCGGGGTCCCTGTCGACGCTGGCTTTGTTGATCCGCAAGTGCCCAACGCATTACTTGGCCGGAGGTTTGT
CGCTTGCTTTTGTCCTCCTGCACGACGTACTTTGGATTACTGAATAGAGGCCCTTTTTGTCATTTTGGTGGTATACTTTCATCAAGTAGTACGCTTTTCG
TA