Description :
From Genome Similarity Track
Location :
Scaffold_42:14800- 41434
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_42-fgenesh-gene-0.18Protein phosphatase 2C
Pytir_DAOMBR486maker-pir_contig_42-fgenesh-gene-0.19Ribosomal protein L15
Pytir_DAOMBR486maker-pir_contig_42-fgenesh-gene-0.4Enoyl-CoA hydratase/isomerase family
Pytir_DAOMBR486maker-pir_contig_42-fgenesh-gene-0.5DUF1279 domain-containing protein
Pytir_DAOMBR486maker-pir_contig_42-snap-gene-0.49Phosphatidylinositol kinase (PIK-L4)
Pytir_DAOMBR486maker-pir_contig_42-fgenesh-gene-0.6Mitochondrial ribosomal protein L51/S25/CI-B8 family protein
Pytir_DAOMBR486maker-pir_contig_42-fgenesh-gene-0.22Eukaryotic translation initiation factor 1b
Pytir_DAOMBR486maker-pir_contig_42-fgenesh-gene-0.7Microtubule-associated protein
Pytir_DAOMBR486maker-pir_contig_42-snap-gene-0.35Microtubule-associated protein

Sequence
26634 bases(100 bases per row)
TATCTTTAGAAGAACACGACCAGCGCCGAGATGTTGTCGCAACTGTTGCGCGCGAGCGCTTTGTCGACGAGCATGCGCGCAGCGTGCTTGTGCTGACTCA
CAGGCAGCTTTGCGACCAGATCGACGACCTCCTGGTCTTCCAACTCGTCCCAGACACCGTCGCACGCGAGCACGAGAAACGGGAAATCCTGCAGAGGCTC
CAGTCTACAAAAGTGACCAAGTCAATAGGAAGATAACAGCACATCACCAGGTACAGTATAATAGTGTAGAAGAAGAAACTAGGGTCGAACCCATTAAGGT
GATGTAATGGTAGCTCACCTTGTAGCGACGGTGGTCGGCTTCCCCAGAACAAACTGCTTCAGGTCTCGATCTCCAAAGCTCCTACAGCAAAATGGCACCA
ACACAACAATGAGGCAGTTGATGGGACACCATTCAGCACCTCGTCGCCTGCAACGGACGTTGACAGGTAGGTACCTAGAGACCGCCAAGACACCAGACAC
GCGGTGGTGGATCACGAACCCTCCGTGCTGTGTAATGCGTGCCATCTCGTCCGGGTCATCGGCTTTGTGGTCCTACATAGCAAAGCGGCAGAGTATTCCT
CTCAGACTCTGTTGTTCATAGCACAGCTTTGGGCATTCGTATCATTCGGCTTTACCTTGGTGAGGCGAACAGCCTTGCCCTTATGGCAAATGACGGCGCG
ACTGGGACATGGAAGTGGAGGAATGAACACTCCCCAATAAGCTCACTCGATGAAAACAAAAGGCTTGCCCTCACCGCTTGACTCACCTGTCACCAACGTT
GGACGTGTAGAGCGTGCGCTGTTTGTCCTTTTCTAACAGCAGCGCAGTGACAGCGGTGGAGCCCATCGAGCCTGGGAACGACTGGCAGCACTCCATGTCT
GTGATCACGTACGCTCTGCAAAGCCAATACGTAGTAGTATGACTGAGTATCACCACTGCAGTATGGAACAGCTAAACGCATGCAATATAATAGCAGCGGT
TCGTCGCACCTTTCTATCCGCTGCTCGACCGTGGTGCCGTCGTCCGGCTGCTGGAGCTCCGTCGTGAGGTTCTCGTGAAGCACGCTCTGGAGATACGCAG
ACACGTCCCGTCCTAGCGTACATTCATTTATCCACACCAAGTGTATATGATGAATATGCTAAGCGCTCTCTTGATGAACACATAGTAAGTGTGCGCTAGA
GCAACGTATGAAGAGAGAGAGAGAAAGAGAGAGCACCTCCGTGGCCGTCGTACACGGCAAAGAACCCGTTCTGCGGGTTAAGCAGGAATCCGTCGACGAT
GCGGATCGTGTCTTCCATGGTCTTGCGGTTCTCTGGGTTCTGTAGCACACGCAGATTCACACATATACATGTGCGCATGCGTATGAGCTTTTCTAATGAA
CACAGAGCGCACGCTTGTTGCGCAGACGCAGCACCGTTGGAAGTCTTACCATTTGCTCGTGGAAGCTCACGCACTGGCAGCAATTGAAGCCCTCCGTCTC
CATCATCTCTGTCTCTCGCTGTCAGCGTCTTGAGCTCTGTAGGCATACAGACGACAGGTGTGCGCAGGTGCACAAGCAGTCAGTAATGTTGTTGTGCGCG
TCCACCTTGAATCTCAGCGCCCCAGGCGTGCGCGTCGCCGCGGCGCGCCATCGTGCCCTTCCCACCTTGGTCTTCTTGAGTGGCTTTGAAGTTCAGAAAG
TGACACCAAAAGGCTTTTGTATAGAAATTTGAAATTTGTATGTGAGCACAGAGCACGCGTCAAAGTCGCCACTACCAAATCGCTATTGATACGCAGTATC
ATTACAACAAGGTGGCCAAAGAAACACGAGAGCATAAAGCGCATGTTTAGAACAGAAGAATGCATGCACGGAGCATGAGTAGTTGAGAATGTCATGAGAG
CACGGCACGAACGAAGCCGCTTGTTTTATCGTTTATCGAGGCTGTTTACCATCCGCTATATCCTAGAACGAGCGAGTGACAACCAGCTACCAATCGCCGA
CAGCAACCAGCGAGCGCGCGAGCCATTGTACATCCCATGAACTGAGCCATTTGCGAACCAAGGCCACCACGGGGTTATCACGCTTAACGGTAACGACGGA
GCGACAGGGTGTTGCGGCGCTTCCAGTTCTGGCGGTGCGACGAACCCTGGATCTTGTTGGCGCGGTGGCCGCGCTTGCGGAGACCACGTCCCTGGCGACC
CGCCGACGTGAGACCACGCTGCTGGCGGCCCTTGTGCACGGCGTTCGCAATCCAGTTGATGCGTGGGTCGCGACGGATGGTCTTGTGCGAGTAGTCGACG
AGGATCACTTCGAAGTACTTGTACGTGGCGTCCTGGTTGATCCAGTACGAGTTGAGCACGCGCAGGTTCGTGAACTTGTTGCCGGCACGCTCTTCGGCGA
CCGAGCGCAGGTTGCGCTCGAACTTGAGCTGGTTGATACCGTGGTGCTTTGGCTTACCGTACACAATACCCTTGGAGTTTGGGCGCTTGCGGCCACCGCG
ACGGACGGCGACGCGGGCGACGACGTAGCCCTGCTTGGCCTTGTAGCCGAGGCGGCGAGCCTTGTCGACGCGGGTTGGGCCGTTCACACGGTGGATCACT
GGCAGCTGGCGGTACTCCCACGCGCGCACACGGAGCAGGAAACGGAGCACATCCGACTGCTTTCGCTTCCACAACTCTTCCAAATACTTGTAGGCACCCA
TGATTCCTGTCTTGGTTTAAAAGGCTAATGACCGGCTCCTCCATTTCCAGTGCCAAAACCAAAACCAAAACGCGACCTGCACAGCCAGCCATTCATTTTC
GAGTGGACGGCGCAGGTCGCACGAATGTGACCACAACAATGGAAGCGGAGGTGACACGAGTTTCATTCAGCAAATCGGTTTGGAAAAAACCGGTACAAAC
CGACGCAACACCAGTTCTATTCGTGCAACATTCATCTGCATCGTACTTTAACGATCACACACAGCACGCTTCTGAACTTGAAGTTCTTCACACTCAACCC
TCGATAAAGTGCGATAGGTGGTCGTCTTTCACTTGTGTTGACAGAAATGGCCGCCTTCACATCAAGCCAATTGAAGAGCGCCATTTCCAGATTCGCACCG
GATCAAGAGCACCAGCAACGAGCGCAGCGGAGAAGCCTCAACAGAGAAAGCAAAGCAATCACAATGGCCATGACGATGCGCTTCCTCGCGCGCACCACCA
CCTCGGCTCTGAGTATCACTACGCGCAACGCACTGCATGGAAGCCGCTCGTTCAGCGTCGTGTCGGACGCACCGCAGTTCAAAGTGGAGCTCCTCAACGG
CGACCACACCGGCGTCGCGCTGTTCACGATGAGTCGCCCGGAGGCGCGCAATGCGCTCGGCAAGCAGATGATGGTCGAGTTCCGCCAAGCGATGGACAAG
ATCCGCTTTGACACGAATGTGCGCGTCGTGGTGCTGCAGAGCACGGTGCCGAAAGGTACGACTTGTAATTCCGTTTGTGTGGTCTAATGGATCCATCGAC
TGATCATGGTGCGTCTTGTTGTTGTTATTGTTGTTATTGTTGTTTGCTGTAGTGTTTTGCGCCGGTGCGGACTTGAAGGAGCGTATCAAAATGACTCCAG
AAGAGGTGAGAGAAAAGCAATACAGCGTGTTTAGCGCATTTCATTCATGATATTGAACATTGGTATGCGTACTATTTCCAGGCTGCTGCGACTGTATTCG
GACTGCGAAGCGGCTTCACGGAGCTCGAGCAGCTCCCAATGCCAACGATCGCTGCGATTGAAGGCGCTGCTTTGGGCGGCGGCTTGGAGATGGCGCTGTC
CTGCGACTTCCGTATCGCTGGTGCGAAGGCGCTGCTTGGCTGCCCAGAGACCTCGCTCGCGATTATCCCAGGTGCTGGCGGCACCCAGCGTCTTCCTCGC
TTGATCGGTAAGCAAACACAACTCAGCAAGCAAACAATCTGGTATATGTTGATGCGCTGTTACTAAGCTGTGTATTTTCTGCTGTAGGTCTCTCCAAGGC
GAAGGAGCTGATCTACACGAGCCGACGCATTGGCGCTGACGCAGCAGAGAAGATCGGTCTTGTGGACTACGCCGTGGAAGAGAACAAGGCGCTGGACAAG
GCGCTGGAGCTCGCGCGTGAGATCCTCCCGAATGGTCCGATCGGCGTGCGCATGGCGAAAGAAGCGATCACGAAGGGACTAGAAGTCGACCAGGCGACGG
GCATGGCGATCGAGCGCGCGTGTTACGCCCAAGTGATCCCAACAAAGGACCGCATGGAAGGACTCCAGGCATTCCGAGAAAAACGCAAGCCTACTTACAA
GGGCGAATAGATACCCAAGAGAGACGTATGTACGCATTCTCGCAGTTCCAGTCGAAACCCCTTCAAAAAAGTTGACGGCGATGATCGCTATTCACAGCAT
TCTACTCACAGCTTCGTATGAGTTTCAAAGCAGTTTGTGCAAGAGTGTCCTGTTTGGTTGCATTGTATTTCAGGGTTATGAACTTAACTATCCATGAGCT
GTGCACGTCTCGACAGTCGTTCTGACGTATCTGCAGGTGCAGACTTTGTTGGTACCACAATGGCGTCTACTCTCCACAGCATCAACGTCGAAACGCGCTC
GTAGTCAAATGTGTGAGGGATGTCGTCGATCGGTACGCTGCGAGCGAGGAACTTCGTATTATTCGCATCAGGCTGGTCGTCCCATTGGCAGCACTGCCCA
CAAGCGACTTGATTTCCAACATTGGTCTTTGTGTGATGCTTCAGAGGATCGTGGAGACAGAGGTGCTCTTGGAAGGCGTCGTAGCCCAGTGAAATGGCCG
ACATCATGAACGCAGAGAACACCACACGCTTCTCGAGAGCGATGACCACCATCAGCCTGGGATTATGGGCCATCAAGTTGTAAACTGCTTTCAGGAATGC
GACTGTGGTCTCATCGTCGTAGAACACGTCACTAGCAAAACAAGTGACGAGTAAATAGGTAGTTACGCATTTTAGATCGGCAATACGTTAAGAAGAAGAA
ACCCCAAGGCAGCTGCAAAAGACCTACCTAGCGATAAGGATATCGGCGTTTTGAACCATGATGCGATCTTCTTGAGTCCAGAGAAACGGCTCCGGTGTGC
CATCATCGGCGTCAGTGAGTTCTTTGTCCCAGTCAAAGACCCGGGTTCGAAGTTCGCCCTATACACAGATAGCTCGTAAAAGGTGAACTTTTCATGCATC
GATCCCTCTGTGGACAACGCTATTAAGTTGTGGTCATGTAAATACTTACAAAACAATTCCGGTCGGCATTGCGTTGCGCAAGTTCCAGCGCAGCGGCATC
AGCGTCGGTTGCAAACACCAACTTCGCGACCTGGGATGTCACAATCGATGCAAAGCCTGTCGAAACGCAATCGCATCGTCAAACAAAACACGTCACATCA
CATCACGGCCAGGTCGAGTTCTTTACGCGTATCGGTGCACAATAATATATAGCCAAGTAAGATAGCATCGAGAACGTTCTCTTACCGATGCCACAGCCAA
GCTCCATCACAGTCTTGTCGACGAACAGGTGCTGTAGTACACAAACAAGGATGACAAACACATGAAGCGCGACGTAAATGTTCACAGTAGTTAAGCGATG
TAATAAGACTCACAGATAGGATAGTAGCATACATGTCCGTCCAACTGTACTTACTGGGTGGGCATGGATGTACTCAGCGAGCAGGAATGCGGCGCGCCAG
AGCTGGGATCCAGCGGTATCCCAGGACATCGCCGACCAGCGCACTTCAATTGCGAACATCTGGCAGTCGGTGCTATCGTCACCGATGTCGTTACCCCCGC
TGCTATCTTTAGCACACCGCCGCCGCTTCTTTGGTTTCCTGCGAGGCACATCGAGATCGCCATCGCTGTCTTCTTGGGGCTTGGTGATGGTACGTCTCGT
GCTCAGCGTGAAGATCGCGAATTCGCTCTAAAGGACGAAGGTCAGCAGACGGATGGCAACACGGGTGCTGTTAGAGAAGGCGATATGCTGTGCATCAGCT
TCGATAAGAGGAGGTCGGTGTACGCACGCTGTCGTCGTGGGCTGTCACTGCATGCTGCTGCGCTAGTTCCAGCTCCACTTCCGAGAGCACCTGGTGGTGT
GTCATTCCTGTCGACACCGCACGCTGACAAAAATGTCGATTCGGTCGGTATTGCAACATTGGTGCAATCAAATCCAAGTATGGTTGGCTAGAAAGATGTT
TGCGTTTCCAACAAACCATTTTCATTGGATAAATGGTTAGTACTATGTGGTGATTGGCTAAATTAGCGTGATGAGTCTCAACTAAGCATCGCTTTGCAGA
TCGAATGTGTCAGATGACTGACAGCCTCAGCAAAGCGAGCAAGCCAAAGCCCAGCTTTCCATTTTGTCAGAAGCGAAAGGAGCCCAAGCCAGCAACTCGC
AACTCGTCATGCTCCGCACTGCCGCCTACCGCGGCGCGTTCGCCCACGCCATGAAGACGGGCGCCACCAAGTCCTCTTCTGCTGCCTTGGCGTTCCCTGC
GCTGCGCCTGTCGTTCGCTAGTGCCAAGCAGTCGTCGTCGACATCGCGCACTTTCCTCAAGGCCATGCAGAGCCACGCGTTCGCGACGATCCCAAGCAAG
GACGACGGTGAGCAAGCTGCCGCTGTTGCGTCGCCGAAGAAGACGTTCGAGGAGCTGCTCGCGGAGAACGAGGCACTGCGCAAGGAGGTCGCGGACTTGA
AGGAGAAAGTGAAGAACAAGCCGGGCAAGTTCATGTCCGTGATCTCGCAGTTCGGCGTACCGTTCATCATCTGGTGGACGACGCTCTACGTGGGCACCGG
TGCGGCACTCTACGTGGCGTTCGACACGGGGATCATCGCTGGCGCCGACGCGATCAAGTTCATCATGGACCTGGGCCTCGACCGGTTCATTGACGTGAAC
ACGCTGAACCCGACGTACGGCAATATCGCGCTCGCGGCCGTGCTGAACGAGTTCCTCGAGCCGTTGCGCTTCCCGCTGGCGCTGGCGACCATCCCGACGA
TCAAGCGCATCTTTTCCAAGAAGGTGCCAGAAGAGATCAAGCAGTAGGCACAAGGAAAAAAGCAACAGGTCTTACTTACGCCACATTTTTTTTCATATTA
GAGCCGTCTTTTGTCTTGCTTCTTTGCCGCGCTTGGTGCATGTTGATCCTTTGTTCAGCCTGCGACCATTTCAAAACAGACATACTGGAAACTTCTTGTC
TAGCAATTGGCTTCTCGTGTATAGCTGAACACCAAATGCCATACTCACGAGTGGGCTCGTCGCCGTGCTGAATTGTCATCTCCTGCATGGCAAAACCTAC
AGGAACGGCATCCAGCCGATGTACATCTGCGCCAGGTTCTCGTGGGACGTCGCCTCGTGGATGAGCTTGTCCACCTGGCCCTGCACCGACAGCGGCAGCG
TCTCATTCTCGGGCAAAATGTCGCGGTGCGATGACGACACGAGCGGCCGGATGGCGTCCCCCAGGTTGTAGATGCCGCGGAGGCGGTCGTCGATGGTCTT
GAGGATGATGCGCGTCTCCTCCTTGCTGCGGTCGTTCGAGATCTCCGCGATACTCCTCACTCCAGACGAGCCGCTCGGCGCAATCTGCGCCGCTTTGCCT
TTCCGTCCCCACTCCACGAGCGGGTCGTGGATGAACGACTCGAGTACGCTACGCAGCGTCTCCTTGTTCTCTCGCAAGAGGTGCATCGTCACCTCGCAGA
CGCGGCGGAAGACACCCTCGTACCCTGTGATCCCGAACGCGTCGATGATGTTGGGTGTCAGGCGGAACGGCACGATTTCGGGCTTCGCGAGTTTCAGCCC
CTTGTCGAAGAGGCAGTCAAAGTCCACGTGCACGCACTCGCCGTTCGTGCAGTCGATCAGGATGTTCTCTCCGTGGCGGTCGCCGAGCCCGATGATGTGG
CCGACCATGGACCACACGGCAGCGGACCGAGAGAATGTCATGCGGGACTCAAACCACGCCGTCGGATCCGCGAAATTGTTGTAGAACCACTGGTGGAAGC
GCGGCGTGAACACGGGAAGCGACAGCACCTTGCGCCGATAGTACATTGCCATCGCATGCACGTCGGTCGCATACTTCTTCTGCATGCCCAGGAACCGCTC
CTTGATGTCGTGCGTCAGCCGCACGGGCTGGATGAAGCCGCGCTCGGTCTTGTGGATCTGGCCGATCAGCTGCCGCATCGCTTTCGTGTTGCGCACCCAC
TCCATCAACCCGCTCTCTTCGTTCAGACACACGACGGCGTACGTGCGCAGCCGCAGCTTGCGCTTCCGCCCCTCGCCGTCCTTCTGTAGGAGCTTGTTGA
TCATCGTGTTGAACTCCATCATGCGGGCGTCTTTGCGCAGATCGCCCGTCTTCTCGCGCTTGCACAGGAAAGGGTAGAGTCGTCCGTCGCTGCCCAGGAC
CTCGATCCGCTTTGGCTTCTCTTTGGTCATCATCACGTCAGCCTTGTCGCTGAACGCCTTGATGAGGATCTGCGCGTGCGGCGAAAACGCAGCGTGCAAT
TGGTCCTGCGGCGCCAAGCCCGAAGCCGGCAGGACCGTCGTCAGCGCCGTCTGCACGGGAACAAGAATCTTGCTTCGAATGCGGCTCAGCCGGATGTGAA
TCTTGCGCTGGTTGGCCGGGTCGTGGCCCGCGAGACTGATGAGCTCCTCCACCAGTCGCATGCCCTCGGAGAAACTGTTCGCGATCTCCTGCTGACCCTT
GGAGACGAACTGGCGCTGGATGTTCGCGATGATGTCACGCGCGCGGTTGCGACGCTGCGAATTGAGCGAGCGAGAGAGCCCGAGCAGCGGCCACATCGCC
TGCGTTGGGTACGCGCCGAGCACCCTGAGCATGATCTTCTTCACGCCGTCCACGACGACCGGGTTCGGATGGCAGATGCGAGACGTCACCTGCGGAAAGC
AAACCAGCCACTCGTACGCTGGGAGCTTCTCCACCGCGTTGTGAATGACCTCGGTGATGTCTGCCAGGATTTGTTGCTGGGTGCTGGACTGACTCGACTC
GAACTCAGGGTGGCGAAGCGTCTTGTTCGCCTTGCTCATTTTTGTCCCTGACGCGCTTGCGTAGAGTAGTTCACCGTATTCAAACCACAGCGTCAGCAGG
CGAGGGAGCGACTGGAACACGAATTTTGTCCCGTGCTCAAGCGCAAGGACGTAGTTCTTCATCAGATTGATCAGGTGTGCGTGGAACACTTCATCCAGCA
AGATCGAGCCTCCTTCTTCACCCATGGACGCAGTGGCATCCGGGTGACTCACGCTGAGCAGGTACTCATAGTACTTTGCCAAAAAGAAGTACCCTTTTTC
CCACTCGGGGTCGAACTTGATGACTGCTTCGTACCGCTGAATCACTTTTTTCCCTTGTCGCTGACCGGACTCTTGCATCCAGTTCGTTGCCAGTAAAAGA
TTCTTGGCGCAGAAATGCGGGTCCTCAACGTTGAAATCAAGCTTCGTCGCATCAATGTCCACAGGCTCCAGCAGCTGCAGCGCTTCGTACATTCGATCTT
GGCTGACCATCAACTTGGCTTTTTCCAGCAAAGCGTACTGGTTGTCCAATGCCTCGGCGTGCATGACTGCGCTCGATGCCGTGCGCACATATCCTTCCTT
GCGCGCAAGCTTCGCCTGCAGCAGCCAATAGTGGGAAACCTCATTCCGGAGATTCGCTTCTTGCAAGAGGACTCGCCGTAATGCAAGAATCGGATCGCGA
AATTTGAGTGATGTTGGCATCGACTCATAGCGTGTATCCCACGGAGCTTGGTTCTTCCATCGCTGTGTTTTCTCATCCTCATCGGTCAGCTCTCTAGTTG
TCTGCAAGTAGATAAAACCTTGCTCGGCTTCATGCAGAAAATGAAGCTTGTGAAGAAGCGGGTACGCGCGCTGATACGACTCCGCCGAAGCAGCTGCAAG
TGGTCCCATAACCTCGAGTCGAGCATCCTTGAGGTTCCTCTGGAATGAGTCTAGCTCGCCATTGTGCAGACTGTGAAGAACACGGATGAGCTTGAGCTGA
GACACATCAATCCCCCGCAGCCGTGATCCAACACCGCTGAGTCCACCGTTCGCAGCAGCACCTGAGGTTGACGATAACAGCAAAGCGTTCTTCTTCTCAG
ACGACAATAGGTCTGCCAAAAGCTCCCATCGAGAAAGTCGCCATGAGCACTCTAAGGCGTACGGAAAAAGCGTTCCCATAAACTCCGGTTCTTGTGTGAC
GATGCCATTGATGTGCTGCAGCGCACTCTCGAGGCGACCTAGCTGAATCAAGCATCCGATCATGCCGGAGTACAATTCTGGTTTCACTAGCTCTGGATCT
GTCTGCGGATCGGCAAGTAGTCCTCGAGGAAGTTGCATTCCCTGCTTGCGAAACTGGGATCCGGTAGAGAAGAATGCTCGTGCTGAGAGAGCTGTCTGAA
TCTCTTGGATGGCTTGCTCGTAGCATGCTAGCGCATCCTCCCATTGCGCAAGCTGCTCATGATCGACGACTTGGTGCATCAAATCAGTCAGATTTAGACC
ATCTTCTCGATCTCCCACACGCGCATCACTTTCACCGTCGTTATGTCGTTGCGCTTCATACAGTCGGCGCAACGTTGCGAGTCCGATGAGGGCGTCAGGT
TCGTCGACGCTTTTGTACAGCTGCTGCAAGTAGAACGCATGCTTCGACACTAATGAGAGGTGCACCGGCCAGATGGAGGAAGTGTGACTGGGTTGCTTTC
CGCCCGCTGGCTTGTAATCTTGCTGACGCAGGTACACTTCAAAGTACTGAATCGCTCGTGCATACGCTTCGATTCCAAATGCTGCATTCGACAGCGCCTG
ACTCGGGATGTCCTTCAGAAATTCTTCGAGATTTTCTTTTTCTTGATCCTCGAGCTCGGACGGAAATTCGACGGACTTTGCTGACCCAGCACTTTGTCGA
CTTGCGCTACTGCTTAACGCGAGTCTCTTCTTCTCGCTGCTCCACACCCACTCATTCAACTCTTCGATGGTGGAGAAGATGGTTTGCGAGCATTGATGAT
GGCGGCTGGAGTCTTCGCCGAATGCAGTCTCGTCGTCCGGACCATTGGTCCCTCCTGTTGATGACGAAGACGTGGTCGTCGGGTGGGCTTCTGAAGGAGG
AACCATGTACTCATCAACCATGATTCCTCGGTCTTGGTCGTTGAGGACAGCCATCACTTCGCGTTTTAACTCTCCATACAATTCAGATCTCCCTGAACGC
AGCACATTCTGGATCAAATACGGAAGCAAAAATCGGGCGATTTGAGGACACGTCGATAGCGCATTTCGGCACGCCAAGAAAATCTTCCGCTCGGGTGGTT
GAGACAGGTCAATCAGCCGTTTGCACCACGACAGCAGCCAGTCTTCGTACGACGTCCCATGCTTCTCGTAGTAGGTGATATCATCCAGAGCTGGATGGAG
ACCGTAGCTGTTACTCTGCTGCCGCCGATTACTTGCAACAGAGTAGTTAGTTGACCAATACGGCTCAACAAACTGCAGAACCTCTTTCCTTTCGAATCTT
CGCTTCATCCACTCGGGCATTGGCCCAGCGGGTTTCGCTTTATGATACCCTCCAGCTCCATTCGAGATTGTCAGATTCTGTCCACTGTGCTGAGGATCCG
CAGTCAGCTCCGCAAGAAATTTCAACAGCTCTTGGATCGCAAACGCGACAGAATCTGTATTCTCGGGTGCGGCGCGCAGCTCTTTCACTAGCCACACCTC
GATCAGTACACACGCCAAGTCCTTCGTCGAATATTCGTTCCGCGTGCCTGCTTTGTCTTTTGCAACAATTGTACTCTGGGTTGATCCGGACTCGTAAAAC
ATACTCAGCGGCATTCTCGCAGAATCAATCGCGCCAAGAGCCCCGAGACACCTCGCGCATAAAAGCTTCACGATTTCTTGACTCTCCGTTCTCGCGAGCT
GCAAGATGGACAAAATGATGGCGACAACGGCTCTATTCACGAAAAGATCGCCTTCGTTTTCCATCAACGCTGTTAGCTCTTTTCCGCGAATAACCAAGCA
CCGGAAGAGCTGTGTCAGAGCTATCTCGCGAACTGCCATGTCCCAGTGGTTGATATATGATGCCAACTCTGTCAAGTATTTGTCGAGGGGCTTGTGCGCT
GGGTCTCCGACGATTTCATCCCACACTGCGTAGATCCCGTCGAGTTCGGGGATAGATGGAAGTAGCGGGATAAGCGGGAACGCTTGCTTGAGCTCATCCT
TCTTTTCAATGAATAAATACTTCAAGACGCTCATGGCAATAGAGGCTGCACTGGATTGCCTCTCACCGACTTCGCTTGGATTTGCAGCTTGAGGGCCTTC
AGGCGATAACACTTTCTGAAGGACATCGATGTTCCAATAGAGCTTGAGCGCACTTTTAGAGTCCATCTGCACGGCTTCTTGCAGAATCATTCCCGGGTCG
TACCCTATGCACGGAAGTAGACTCACGACAATTGAGCATAAGTTGGCTTCAAGCGCCTTGATGGAGAGCATCTGCAGAAACATCGCCCATGCGTTCATCG
CGTGATCTTGCAGCTCTCGCTCGGCAAGTCCTATCTTCAAAGTTGCCATTACTTTTGGCACAAAAGTGTCCATGACTCCATTGCTACCTGCGCTCTCTGA
ATCATGCGAAGCCGAATCCTTGAACAATTCCAGAAGTCGCTTGATGCTCTTGATCGCTCTGATTTTCTCTGCCGCCAAGTTTGAGCCTGCGCTTTTCCCG
CCAAGTCTGCCTCCCAATTCAGTCATCACCGCCAAGAAATACTTGCGAGGCATCATCATGTTGTCCAAGTCCGTCGTGCTGGCATCTGGGCTGATGTCAA
CTCCTTGATCTTCAATAAGATACTGCGAGATCTCGGGGAACGCTCTCATTGCCGCGTCATATCGCGGACCCCCCAGCTCCCAGGCTACGAGGTTCAGCAG
TCGAATCGGCGAATGAGAGACAACGTCGCGAATTGTAGTGTTCTCTTTGAAGTACTTGAACAGGAACTCCCATTCTGCGAGTCGATTGTCGTTATTGTCG
GCTTGGACTTGATGCATTATCATCTCTTTCAGCACGTGCTCGATATGGCTGTGCAGCAGCTCCGACATTGTTGCGTTTCGGAAATCGCCTTCTGATCCGT
CTTCGTATCCCCCTGAATCTTCTTCTTCTGCTCCGTTGTACTCGATGATGAAGGTCTGCAGCATCTCTTCGTTTTGATCAACGACATATCGTGGGAGGAC
ATACTGAGCACTTGACTGCAGGAATAAATTTGCATCCACCTTCATGAATGTCCGAAGAAACAGCCGGAGTGACTTCGACGACAGTAGCTCATCGACCAAA
GGGTAGTAGCAATGATCAGGATACTCGACGCACAATCTCCGCCACGAAATCTGGTGGTGTGTCGTAATCCGATGTATCTGGTCGTACGCAGATGCGGCAC
ACTCTTTGACTTTGTCGATGTGTGCCTTGTTCCAAATCGATACCAGACGAAGCATCACGGAAATCAAAATTTCCATGTGATCCATGACGCCGGGGTCACA
TGCGCATCCCAATGAGCCTAGGATTGGCATCACAGCAAGAAGCTTGGATACGTCGGACGTCTCTTCAGCCTTCGCAAGCACTGCATTCACGCTCTTGATA
AAGGATTCAGTTCCGCCAACTTTCGCCGCGGATAGTACCTTTTGGGCGAACGGAGGATAGACTATTAAAGCCTCGAACAGATCCAAGACGATCTGACAGC
TTGACAGATCTTCTAGGCAGATCTTGAACATCTTGCTGAACCTCGACAAGATTTGTCCATCGTCGGCACCAAGATCGCAATGCCGAAAAACAGATGCCAG
CCAGCGAATTGCCATGACACGCGTCTCGCTTGCCAGCGATATCAAGTCACCTTCCATGAATGCCTCAACGAGCGGCGCAGGGACAGTGACCATTCTTGAT
TTTGCGCTTGTTATTTGCCAACACTCACACAGCGAGGTACCCCTGGATCTTGACGGCAACGTTGGGCTTCCAAAGGCTTGGTCAATCAGAGTTTCGTCAC
TTGGGAACTTTGTATCACGAGGCTTCGAAGCGATGCAAAGTATAGAGCTGGCAGCATCCAAAATGATCCTTCGCAGAAAATCTGATGCTCCCCCTTGGAT
TTTCGTTGCCAAAAGCTCGAGCAAGCCAACTGCAGCAGCAGTCGAAGAATTGCAATGACGCTTCAAGAGAGGCACCAGCAGCGGAAGCATAGTAACCGAA
GCGCACGCAACTGATTGCGGATTTTGCTGGTCGAGAATCGATCGAGAAGTCGTTCGCCATAGTTCGGAGTCTCGCCAGGAAGATTCTTGGATCATCTTCA
GCGCTTTCGTTCGCGACCACATGAAATGCATCAGGAAAACTGCTCGAAAACGCAGGTTTTTCTCGGTAAAAACCTTCGACACGAGATCCATCTCTAATGC
AGAACCGAACAGCTCATCCTGGGACATTTCGTTGTCGGCGTCTTGGTCTCTTGTCCTGAACGGATGCGCCATTGCCGCCACAAGTTGAGTCCAGGAGTGT
TCTGTCCACGGAAGCGCCTCGCTCATTTCGTCGTCCGAAGCAAAAAAGCGCTTGGATTCGATTGCCGAGAGAATGCTTTTGAACGTTGCCTGGTACTTTC
CGATTTCATTGTCTTCGAGATACCGGAGAACGACGACCAGAAAATCCATAACTTCATCGGTGATAGCAAATGCTGGTAATGTAAACCCCCTCATCACCGA
GTCCACTCGCTGAATCAAGATACGGGAAATCGAGTAGCTCTCGGCGCGTGCCATGCTCGCGATGCAGTCTCGAAACGGGAGAACAATCCGAAGCGCAATC
GACAACGCTACGATGTCAGTAGTACCATCATCGCTGCCAAAGAAAATGAGATCCAGAACCCACCGGGCCAATCCGTCGTATACACGTGCTTCATCTGACA
GCTGGAACACATTCGATGGACGATTTATTGACGCGCTTTGACGAAGTGCACCGACGAATACTCCACCGCGCGTTCGCTTTCGACTTGTGCTGGTTAGGCT
TCCGTCTTGTCCCAGCTCGAAGCTATTCGCTTGGATGGATTTTGCGAACGAGTGGGAAAACTTGAGAAGCAGCGGTCTTGACGAAAGGATGAACAGCACC
CAACCGACAACAGCTGACTGGCTGGATGGGTCAAGCTTGGTCATATCGGCACAACCAAGCAAATCCAGGAAGACGGAGACCCGTGGTGAAGCCGTCGACG
TACGCAGATAGCAAACGACGATTTCCATCGTGCGCAACCATATCTTCTGATTCTGCTGTGCGCTCAAGTTAACTGGAGTGTGATGCGATTCTTCCGATCT
GAACAAAGACCGCAATATCCAACCATCGAGTGCTGGCCACAATGTTTCAGCAGCAAAGTTGGAGATCCGATCATGCCCGTTCCGAATCGCCTTCAACACC
AAACTTATATAGCCGGTCAGTTCAGACCGCTGCAGATCAAACGTGCTGTGCTCGTAAAACGCCAACACCAATCGAACAAACTTCCTTTCCGTCGTCCACA
CCAATTCCAGCATCGTCCGAAGAAGACTGAACGTAGCTTGCGTGACTTCAGCGGTCTCTTCTTCCGATATCCGGACCTCTCTGGATACGCCGCGATCCAC
TCGCAGCGCGTTGTCTTTCTGCACGAAGAGTTGCACCAATTGCACGAGTTTGTCCAATGCAGAGTCAGTCGCAACTACAGCATCGCTTTGTTGAACGATT
CGCTGCACCAACACAAGCATCGATCTTCGCAGAGCAATGGCGTTGCTGTAGGATTCGACGTGGATAGGCGGGAGCATCTTCTTTAGTTGCTGTTTCCGCT
CGAACAGCTTGGCTTCATCGGTTATGGGCTCACACCCACAGAGTGTGATGCTGCTCTTGGAGCCGAGCGGGCCGTCCGCGTCTTGGTAAAGATGAATCGC
TGTGTCCAGATATGAGGCGATTGTTGCACCGGCAAACGTAGGGTCGAAGTTGCGAGTTTTTAGGGATTCTTCCAGCAAAAAACAGTCTTGGAGCACTTCA
ACGGTATCACGGAAGAAGTGCATGAACCCGTAGACGTCATTCTGCTGCAAAAACAACGCCATGTGAAGGATCACATTCAAAACGCTTCCTTGGGCATCAC
GGAGACTCGTGTTGGAGTAGAACGACACCATGTAGAACAACATCGTCGCGAAAGTCGGATACGAAGACGCAGACGCTCCATTCGTAGATGCTCGCTTCTG
CTTTCCATGCGGGGACCTCATTCCAGAGCTGGTCACTGCAGCTGTCAGAGCTCCATTTCCTTCCACAAAGAGCATCATCGAGTACGGACACACACTGCCA
CGCAGCAGCATCTCCACAATCTCGCATAGGTCCCGCAGCATTGAGACGCCAGCGTCGACGGGCACACTCGCAATCGGACGCATCAGCTTGGGCAACAGCT
TTCTCAGCTTTGAGAGCATTGTCTTGCAGCGCTGGATCGCCGTGGACGCGGTGGAGTCGTATGCCGGGTTGTCATGCTGCCGCTGGTGCGCGCGCACGAC
GCTCAACAAGCTCACGATGTCGCTCTTTGGGTCGGCGTCGCCGCTTGCAGCGTCGGGCGGTGTNNNNNNNNNNNNNNNNNNNNNNGGCGCGCGCCTTTCT
CGACGTCCGCATCATTCCGCATCGCCGCTTTCCTTTTTGAGTGAGTGCGCGCACGCGGAATTTTTCAGTTGCCATGGGCAAACATGGGCAAACATGGCTG
GAGTTTTGTAGGCTAATCGACACACTTATCGTGGTATATTTCATTAATCTATCATTAACAACTATCATTCTTGATTACAAAATAATTCATGCATGAAATA
CACCATCATATCGTATTTACAAGAGCCATCACGGTGAGTTTGTGGTGCAAAGGATGGAGTGGAGCGCATTTAGCCCATTGGAACGAACACAAAGAGCAAA
TCAAGCGACCATGGCGACCAAGGGAGTGTGGCAGCTGAAGCAAGTGACCATCCGCTACTGTCAGCACAGCGGCAGCAGCCGCAACATCAGGTGAGTCAGC
GTTGCGTTTATGCGCGCGCGTATGTGTGTGTGTGTGCCGTTGTAAGCCATTTACCAGGGTCTGCGCATGCGCGCTAACACAGGGCACACGCGTCTCTCTG
TTCACCTCATCTTGTCTATGCCGAATGGTACTAACTGTCGTTTACTTTGTCGTTATATGTGTACCTTGCCATCACGATTAGAAAGTTGCTCGGCGATGAG
CGCTTCTTGAACTTCGTGAAGGAGAATCCGCAGGTGAAGTTCCAGACGGAACTGAAGGGAGCGCGCCACCCAGTGCTTATCGGTGACTACAGTAAGTGCC
CTGGCGGAAAGAAATTTAGGAGAGCAAAGTGGGGAGCGTTAGTTGGCTCTAATGTTGTGCATTTTTGTATTCCGTGTACAGTCACCGACGATCAGAAGGT
TTGCGACGTGAAGAACCAGGACGTCGACTTTGTCATGATGCAGGTGCGTAACTTGATACAATGATTCTCCATCGGTACTTGCTGGAGCTGCTTGGGTATT
AATTAATGTGGGTTGTACCTAATGTAGCTTGAGCGCTTGCGAAACTCGAGCGGCCGCAAGATGACCCGAATGAAACGCCCGGTGATCTCGAAGCGACCAA
CCATCCAGGGCATCTGGCAGCCAGACCTTGAGTTCCCAGAGTTCAAGATCGACCACCGCGTGTAAATTGGACGAAGGAAGCAAGGACGAATCGAGCGAAC
GAGCAGAGCTGCAATCACAGCACGGATAGCAATCATTCGGAGCTTTGTAGACATGGACAGGAAGAATATACAGCCACCTAATCTTTCTTGTTTAACAGTA
AAGATGCTGTGAATCAATCAATCAATCGTAGCTCAAGTGCTTTTACATTTTAGAGACTATCGGATCTTGACCGTTTTGCTCTTCTTCCTTAATCATCACA
ACGCTGGCGAAAACAAATACAATCATCAAAATATATTCATCCGTCCAAGAAAGACAGCGAAGACAGAACATCCACCAGTTATAGCAGACCCGTATCGTGT
GCATCCGCATCATTCATCCTTCTCTAATCATAGCGATGCCTGTCTTCTCCACTTTCTCTCACTCTCCGTTTAAAAAACTTACGGTCGATGCATCACTCGC
TGGCCAAAGCAAAGGCTCGTTCGTAACCACGCTAGAGCAGCTTAGCTTAGAAACCGTGCAACACCAGCTGCGAGTCCGAGCAGATCTCCTGGTCGATCAG
GAACTCGCGGATGTTGGTTCGCTGGTCGCCCGAGAGCTGGATAATCTCGCCAAGCTCCTCGTCCTTCACGAGCGCGCCGTTGCAGCTGAAGTTCTTCTTG
AACGCCTTCAGGATGCGCTTGATGTCGAGGTCGTCGGCGAGGCCCTGCACGGTGGTCAGACACTTGCGGCCGTTACGCTGCTGCACACGGATGTGCACCT
TGCCGCCGCCGATGCCCGAGTCGTCCTTGGCGTCCGCGAAAGCGTCTACAGAGAGCCACACACAAGAGACCACACAGATATGATGAGCACACAGGAAATA
CACACACATGTAGCCACACGAGCTGTGCGTGTCATAGGCGCTATAGCCTCGCATTGTGTCGTCGTCATGTACGCACCGAAAGTGGTGAAGTTCTGGATAT
CGGCCATCTTGCTTGTGGTGTTCTGCTTTCTTGGAGCGAAAAAGTGCTGGTCAAAGTTTAACTGGTGTCGAGTGATGCAAAGGGGGAACAAGCAGGCAAA
AGCACCCCCTCGTGCAGCAACTTTGGCTTGCTAGACCAGCAGCTGGAAGCACTATCGAGTTGCAACTTTGAGGTCGAACCTCTCCCATCGAATTTTCGAG
ATTTTCATTGGCTAAAAAGAAGAATTTGAGGGGTATTGATTGGTTGAAATCGGGAAGAACGCGAAAGGATACACCAGAAAAGCTGGTGCGTTCAAAGGAA
GCGCCATTCGAAAATGGAGCTCACGACGAAGGTGGCGTTGTTGTGTGTCCATATCACTTCATGATGTTCATACCCCCATTTTGCACGTATGCGAAATGCG
CATTTAGGATACTGATGGTGAGCGTTCACATTAGATGGCAATTCCAGCGGATATATTCCTGTGACGTGGTGACTCGTCGTCAGCAATGTACCGAAGAGGC
GCGGGTGTGTACCAATCCGACCTTTAGTTCATCAAGCTCCGGAAGCTCTGGAAGCCCGCACACACTGATACAAACATATACCAAGCTACGTAAAGGCAAG
CCGTCATGGGCAACACGCTGCACGCGGCGATGAAGGACCATGACGCGTTCGCGCTCGTGGATGCGATCCTTCCGTACGACAACCTGCACGTGAACGCGAT
CGAGGCGTACTGGCGCAACTTCTATGACTGCGCGACGTCGTTTGCGCTCTCGAAGGTGCAGCTGCAGCAGATCTGCTGCCGCACCGCGTGCTTTCTGGAC
CCGAACGCGTCGACGCAGCGCGCGACGAAGCACGCGGACCAGGCGTTTGAGCTCTTCCTCGATTCACAGCTCAAGCAGTACAACCAGCATAGCCAGCAGC
TTAACCAGCATACTCAACAGATGCAATACCAACGCCAGCAGTCGGTGATCGACGCGCTCGAGTTCTTCTCGGCGCTTGCATTTGTGAGCGCGGCGTCGAT
GGACGAGAAGATCGACCTGATCTTTGACTCGTGGGACATGTCCGAAGACGGTGCACTCGACCTCGACGAGTTCACGATCTCGCTCAAGTCCACGCTCGCG
GGGCTCTCGCGCATCCTCAAGCCTGTGTCGGCTACGATTGCAACGAAATACAAATTTGACGCGTTCGCGAGCGTCGATGAAGAGGAGATCGATATGCTAG
CTGATCGCGTGTTTCGTGAGATCGCCAATGTTGCTGCTACTGCTGGTACATCAAATACCGGCAACGTGAACCAAATCTCGATCACGTGCGAGCAGTTCCG
GGACTACTGCACGCGCAACAAGACGGCGAAGAACCTGTTTGATCTCTTCGATCTTGCCGACGCGAGCTTCCAAGATGGAGGAGATGGCGACGGCGACGAT
GAGAGGAGTGCGAACAACGTATTCCTGATATCAGAGATGAATGAAGAAGCCAGCAAACTCAAGAGTGCGCTCGCAAAAGTCCAGTCTAAAGCTGAAAATA
ACAATCAAACTCAAGGGTTCTCATCATCAACTTCGATTGCTGACACTGGATTCGGCAACGACGAGGATCCTGGCGACGAGTTCTTGGCAGTGAAACCCTG
GAAAGGCGCGATGTTACCGCCGAGTAAAGCTCCAGTGGTGTCGAAAGCAGCGCCGCTCGTCTCGATCAAACTGGACTGGATCTTTGGCTACAGCGCACAA
GAAATGCGAAACAACGTGCGCTACATTCTCACGAACAGTACCAATAATAACAATGGCCGCCCAGAGGAAATCGTGTACCCAGCAGCCACTGCCTGCGTCG
TCCTGAATACGAGCACGATGAAGCAGCGCCACCATCTCGCGCATACCGACGACGTGCTGTGTATCTGTTTGCACCCAAAGCTGCCATTCGCTGCGAGTGG
CGAGATCGGCAAGCTCCCCAAGCTGATCGTGTGGGACCTCGTGAGCATGGAGACAAAGTGCATCCTGCAGGGCTTCCACCAGCGCGGCGTGCTGCAAATT
GCGTTCCAGAGCGAGGAGTTGCTCGTGTCGGTCGGTGGCGACGACGACCACAGCATCGGTATTTACGAGTCGAAGGATTCGTGGAAGTCGGCGTTGCTCA
AGATCCATGTAAAGGGCAACAAGTCGGTGCCATTCCACATCGCGGTCAGTCCAGTTTCGCAAAATGAATTTGTCGTGTGTGGACAGAAGTACATCGAGTT
CTGGAGCCTTGAAGGCGGCAAGTCGCTCAGCTCCAAGAAGGCGCTGCTGGGCAAAAAGGGCACACTGCAGCCATTTCTGTGTGCAGAATACCTCAAAGGC
TCGTCAGGTACGACCTTGATAGTGGGGACCAACGATGGGAACCTGTATCTGTTCAATGGGAAAGACCTATTGAGTACCGTCAAGGCGCATAGCTCGGCCG
TCAATGCTCTCCACTACTCTGCGTCTGGTATCCTGGTCTCCGGCGGCAAAGACGGGAAGCTCTGTCTGTGGGACGAGAAACTGAAGCAAACCTCTAGACC
GATCGTGCTTGCAGACACCGTGCTCGCGAGCGTGAAGCATACGCAGTACTTTTCGATCCGAAGTTGCTATCTGTCGCTCGACAGGAAAACCATGTTGATC
GGCACGCAGGCGTCGGAAATCTACGAGATCGACGCCACAACGGGCCAGAATGTGCGCTCAGATGCGCTCGCGAAGGGCCATTTCCAGGGCGAGCTCTGGG
GCCTTGACGTGCATCCTCACAAGCAGCAGTGCTGCACAGTGGGTGATGACCAGACGCTTCGCATTTGGGATCTCGGATCGAAAAGAGAGCTCCGTGCTGT
CCGCATGGACTGCCCAGGTAGGGCTTGTGCCTACTCGGGTGATGGAAAACTGATCGCTGTGGGCATCGGCACCGATGGAATCAGTTCAACTGCTGGTAGC
ATAGCAACAAAGAAGAACCCTAAGGACTCAAATGGATCTTCCTCATCAAAGAACCAGGTCAAGTCTTCCGGTGGCTTTGTCGTGTACAGTGAAAGCGACC
TCGCGAAATTCAAAGAGCCCTGCTTTGATCCTCGCAAATGGGTCAGCGACGTCAAGTTCTCACCAGACAACCGCGTGTTGGCGGTCGCGAGCCACGACAC
GAATATCTACTTCTACGACGTGCTCAAAGGGTTTTCGAAGAAACAGGTCTTCAAGAAGCACTCGAGCTACGTGACGCACGTGGACTTTTCGTCGGATGGC
AACTATCTCCAAAGTACGTGCGGCGCCTATGAGTTGCTGTTCAGCGAAGTGAAGACTGCGAGGCACATGACGGCTGCGGCGGCTTTTCGTGACGAGCGGT
GGCACACGATAACGACGACTCTGGGCTGGTCCGTCCAGGGTATTTGGGAAGAGGGCAGCGACGGCACGGACGTGAACTCGGTCGATCGGTCGAAAGACGG
GAACTTGCTCGCTACAGGCGACGACTTCGGCAAAGTCAAAGTGTTCCAATACCCATGCGCCATTGAGAAAGCGTCGTCCGTCGAGCTTCGGGGCCATGCG
TCCCATGTGACGAACGTGCGGTGGTCCTCGCACGATAACTTCCTGGTTACTATCGGAGGCAACGATCGCTGCGTCTTTGTGTGGAAGCACGAGAAAGCTA
CCGGACGCAAAGCGGTCAGCGACGATCCGTACCAAAACGATTTCATACCTAGGTCTGCAACCGCTAACGACAACGATATTGAAAATCGTCGACGAGGCAC
TGATCCGCTGGAGATGGCGTCTGCAGACGATGACGTTGGCGACGAGTTTATGGCCGTGAAGCCCTGGCTCGGCGCCGTGGTGGCACCATCGAACACAGCC
TCGATGCACTTGAAGAACTCTCCACCAGAAGATACGCATTTAGAGCTTGAGCGAGTACACGGCTACCAGGCGCAAAGTGCGTCCAACAATGCGCGCTACG
ACACGAACGGCAAGGTCGTGTACCATGCTGCAGCACTTGGCATTCTATTTGACAAGAGCACCCAGCGTCAGAGTTTCTATAAAAGCCACGATGACGACAT
TGTTGCGCTGTGTATGCATCCCAATGGCTCCGTGTTTGCGACTGCGCAGATGGGCAAAAATCCAAAGATCTACACGTGGAGCTCGAATGGCTCGACTATT
TCGTGCCTGGAAGGGTTCCACCAGCGTTTTGTGTCTGCGATCTGTTTCTCAAGCGACGGTAAGAAACTGGGCAGCGTCGGAGGCGACGACGATCACTCGA
TCGCCGTGTACTCGTGGGAGAATGGGATCCTATCGTCTAGCGCCAAGGGTGAGCGTAACAATGTGCTCAGCATGTGTTTCCATTCGGCTACGGGCGAGTG
GGTCACCTGCGGCGAAAAGCACATTCGGTTCTGGACTGAACAGGGCAAGAACCTGACCTCCAAGAAGGCGATCTTTGGGCAAGCCAAGCACAAGGATGGC
AAGATGCCTGGGACGTTCGAGTGCGTCGTGTCGTTTGGGAAAATGGTCGTCGCTGGCGCGTCGAACGGCAATTTGTACGTGTTCCAGTCGTCAAACGAGC
TCTCGAGGATCGTGACGGCGCATGCCTCAAACGCCTTTGCTTTGTATGCAACAGCAGAAGCAGGCGGTAAAGGTGGTACTGGCTCGGAGCTCGTTTCAGG
CGGCAAAGATTCCAAGATCATGGTCTGGGACTGCGACCTGAAGCCACTGATAACCATTGATCTGAAGCAGCAAGCTGCCGCAGTGTGGCTCCTCAACGCG
TCGATTCGCTCAGTGTGCACAAGCAACCGCTCGTCCAGAGTGTTCCTAGTCGGTACAGGTGGCAGTGATCTGATGGAAATCGATGCCAGCAGATCGACAA
TTGCCGTGAGTATACTCACACAGGGCCATTACGCGATGGAGGTGTGGGGGCTCGCGTGCCACCCGACCAAGCCCGAGTACTGCACTGTCGGCGACGACCA
GACACTCCGTGTCTGGTGCTTAACCAAGAAGACTCAGTTGCGTACGAAGAAGCTTGAGTGCATGGCTCGCGCGTGCGCCATCGCGGACCAGATTGACGTG
ACCGCGGTCGGCTACGGAGGTCGCAACGCCGCCCAACGCGCTCCATCAAAAACGTCGCAAGCTAAGTCGGGTAGCGTTGTGCTGCTGCGCTACAGCGATC
TATCAAAACTGTTTGAGGACAAGCCGTCCAAGCAACCGATCAGCGAAGTCAAGTTCTCCCCGAATGGCGCGGTTCTGGCCGTGGGTTCGCACGACCACCA
CATTTACCTCTACAAGCTGCACGACGCGAGCTGCAAGAAAGTGACCAAGACCGCAACTTTTGCGAAGCACCAAAGCTACATCACACACATTGACTTCTCA
AGCGACAGTAAGACCCTGCAGAGCAACTGTGGCGCGTACGAGCTGCTATTCAGCGATGCGACAAGTGGGCGACACATCACGTCCGCGAGCAGCACGAAGG
ACACCGACTGGCAAACGTGGACGTGCGTGCTCGGATGGCCCGTGCAGGGCATTTGGCCGCCGTGCTCCGACGGGACCGACGTCAACGCCGTGGACCGCAA
TGCGCGCAAAGACCTGCTCGTGACCTCTGACGACTTTGGGCTCGTCAAGCTCTATCGGTACCCGTGTGTGGCAGCAAAGAACGCGGGTTCCTTGGAGTAC
AGAGGTCACTCGTCTCACGTCACGAACGTTCGCCGGAGTGCGAACGACTCGTATGTAGTCAGTGTTGGTGGCAACGACCGCTGTGTCATGGAGTGGAAGG
TGGTCAGAGACCTGGATGGAGCTACTGGTGGCAGTAGCCAAAGCGAACTGGTGATGGAAAAAGGAAGTTCGTTTGAACTTAACGAACGAAGTGCCAATAA
TGACACTGACGGTGATGACGACGACGATTTCGATGACGATCCATCAGGCGATGAGTTCATGGCGGTGAAGCCCTGGGTTGGCGCGATCGTGCCCCCCAGC
AACGCTCCGACTCCAAACTCTCGCGAGCCGGACTTGCAGCTCGAGCTCGATTGGGTCTACGGCTACCAGACCGAGCTCTCACACCAGAACCTGGTGTACA
ACGACCACGATGAGATCGTGTACCACACAGCAGCGGTCGGTGTGATCTACGACCCAGTGGCGCACCTACAGCGCCATCATCTGTGCCACAATGACGATAT
CATGAGCTTCGCGATCTCGAACACCAAGAGGAACGTTGTCGCGACAGGGGAGAGAGGCAAGAAGCCGGTGATCCGCCTCTGGGACGCGCGCACAGGTGAG
CTGCGATGCGAGATGAAAGGGTTCCACACGCGCGGCGTGGTGTCCTTGGCGTTCAGCGCTGATATGAAGCTGCTCGTGAGCGTCGGCGACGACGACGACC
ACTCGGTTGCTCTGTGGGAAGACGCGAGCAATGGCTCCTGGACGCTGGCGAAGCTTCGCGCGACGTCGAAAGGCGACAAAGGTGTCAACCATTTTGCTGC
TTTCTCTTCGTCTCCTTCCACTAGTACAACAATCATCACTGGAGGCGCGAAGCACGTGCTGTTTTGGAGCATCGAGGGCAAGAACATGGTCTCCAAGCGA
GGACGCGTCGGAAAGAAAGGTACACTGCAGAATTTTCCCTGTGGGTGTGCATTTGGCGATGAGTTTATCACTGGAACCGTGAACGGCGAGCTGTACGTCT
GGAGAGGTGAAGAGGTCTCTAAGATCGTCAAGGCGCACGATGGAGAAACGACGGTTGTGTATGCGCACTGCTCGGACCAAATTGACAGCTCAGACAACAA
AGTCAATATGCAGCCATTGCTTCTGAGCGGAGGCAAAGATGGCAAAGTGCTGATGTGGAATGCGAGTTTCCAGTCGCTCAAGTGCTTCGACCTGGTCGCG
ATGAACGCCGAATGTCTGAACAAAGCTGTCTGCAGTGTATTCCTCAGTGGTAATGGACAAAAGCTGCTCGTTGGAACCAGGTCGAGCGACATTCTCGAAG
TGGATGGATCTTCAGGAACACTGTTGAATGGTGGGAAGCCGCTGCTTTCCGGCCACTATGCGAACGAACTGTGGGGATTGGCAGTCCACCCGTCTCGTCG
GGAGTTCATGACAACTGGAGACGACGGTACGCTGCGAGTGTGGGATATGGAGACCCGGCAACTGACTCAGCTCACACGTCTGCCTTCAAAGGCTCGGGCG
TGTGCGTACTCGTCTGATGCGATGATGATTGCGATCGGACTCGGCGGAGACAATGGCAGCGGCGCGCGTCGAAAGGGTGGGAAGCAAGCACAGGCCAAGT
CGAAAGAAGGCGCGGTCATGATCCTGAGTACTGGTGGTGGTAACGGTGGCAATCCAATGGACACAAAAGTGCTGTTTGAAGACACGCCCGCGAAAGAGTG
GATCAGCGATGTGAAGTTCTCTCCCTGCGGCAAGCAAGTCGCGTTTGGCTCGCACGACAACGCCATCTACCTATATTCACTTCAACAGCAGCAGACTGGT
GGCGCTGTTGGGCACCACCTGGAGGTGAAGAAGCGCAAGCCGTTCGCCAAGCACAACAGCTACATCACGCACTTTGACTTTTCGGATGACAGCAAGTTTC
TCCAGTCGAACTGCGGCGCGTACGAGTACCTCTTCTGCGACACCTTGACTAGCGAGCAAGTGCGCTCGGCGTCTTCGGTGAAGAATGTGACCTGGGCAAC
ATGGACGTGCACTTTGGGCTGGCCCGTGCAGGGCGTTTGGCCCGAGTGTGCGGACGGCACGGACATCAATGCGGTGTGTGCGTCTTCGTCGCGCACGATC
CTCGCGACCGGCGACGACTCGAGCATGGTCAAGATCTTTCGCTACCCGTGCATCATGAAAGGGGTGCGTGCGTCATTGGGCTGGGTTCATCCTATTGGTA
CTCTCTCGCATAAAACTGATAAGCTAACTCTTGTGTGTGTGCAGTCCAAGTTCATCGCTGGACGCGGCCACTCGTCCCATGTCACGAGCGTGCGCTTCAG
CTCTGATGATAAGTACTTGATCTCGATCGGCGGCAACGACCGCTCAATCTTCCAGTGGAAGCTGTCGTAAAGCAAAGATCTCTCTTTGCTCGATCTGAAC
AATCAACCGTTGATTGGGTGAATGCGATTTTGGG