Description :
From Genome Similarity Track
Location :
Scaffold_217:14800- 16852
Sequence
2052 bases(100 bases per row)
CTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAATTCATCCACTTGGCGCAAACGGGAAATCTTGGCA
AATGACACTTCATGTAGATCACGTGTATTATCGACTGGACCTAGGGTCCTGCTACCAGGATCGAGCGATGTCTTGTATACGAATGCATAAATGCAATACC
TAGAACGCTCGGCTCGTACCTGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCTGCCACTTCTGGCAACATCCCTCTGTGCTTGGCAGGATCA
AACCATTGGCGGATCTGGTTGTAGAATTCATCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACAACCACGACACACGTAGAAGCAATGATCTCCGG
GATGATCTTTCTTGCCACACTTCTCCCAGACCAGATGTTTTTTAACGTCCAGGCTCTGTGTGCTTCCGGGGTCCGCACTGCGAGCACCTGATTTGCGCTG
TCCCGTCCATGAGATCTCGGGATCTGTACATCCCCGGTCCCCGGGTACGGTATCCCCCGATCGAGAGTTGTCTCCGGTTTTCGCCGTTTGATCGTTGGGT
GCAGTGAGACAGACTCGGCGGTTATCCTCTGGGTCGGAGTCCGAACCGTCGGATCCCAATTCAGTTCCTGAGTTGGACGCCGTGACTTGGTGGACACGTC
GAGCTGGAGCCGTGGGCGTCGGAGCTTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCTACAGCCCGCAGCAC
TTCTTCAAGCTCATCTGCGTCTGGAAGACGTAACAGGGTCAGCTTGTCGGCCAGATCAACATCTCCCAACGTCTCGATCAAATGATCCACATGTTCCCGT
AGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGCAGATGTTCTAGCGGGGATTCATCCGATCTGCGGC
GAGCGTGGTAGTATTGTCGTACCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGTC
CAACTGCGGATACTAATTCCTTGCTGGTCCCGCTAGCAGATCCGCAAAGGTCAAATACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTG
ACTTTGCTGATCCATGTTCTCGCTCGGACTTCGTCTTGTTTCTTGCCCGTGAACTCCTTCAGACCCTCTGGATCATGTACGATCCACCCGCCCCGGCTGC
GGCTGTTGCTACCACTGTTGACGAAGGGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTGCATCTCCACG
TCTCGTGCTCCATGTTCGTGGAGCACTTGCGCTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCT
GCAGAGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCTGTCTGGTCCAGTGGCGAGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAA
TCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCCGGCTGGATTGTGTCAGATCACGCGTAGGGCGTACTGGATCCTGAGCCTTCACGTTCACAGGGACT
TCTTGTCCCCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAG
CGGCGGATACGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTGACTCTGGC
AAAGAGGTCTCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCGCTGCGTCGAACACGTCAGCTACGATGCCCGACTCCGTAAGCAAA
CGTAATAGATCTTTGACTGCCACCAACATGTTCGCCGTTTTCGTTGGTGCTT