Description :
From Genome Similarity Track
Location :
Scaffold_783:1480- 3099
Sequence
1619 bases(100 bases per row)
TCACTTGGGGGGGGGTTACTGTCATTCGGCATGTTTGTGTTTGCGTGGCACGTCGGTGGATGGTTGGTTTATAATCGACCGTAGAGTTGCCGTCGTCGGA
ATTGCCGGACCCAATGTCTGCTTGCTTGTATGCACGAGGTACATGTTGTAATCGCTACACCCCTGCTCAGATTAACTGTGTAGTTGTGCCATGTACAAGT
CCAACACAATGATTGGTATCAAGATCTTATAAGTAGTGGCTTGGTTGCAGCCATTACAGTGTACCGCCAAGCGGTATGGCAAGATGTGGTATTCCGACGG
CGACGAGGTAATTTTTTAACAACGCATAACGCGATAATGAGATACTTGTTAAACACGCCGGAAGATAGGCTTCCCACGTTGTTGCCTGTGAAAATGGCAT
TGgtcttgcagctgcaacaacgaAAAGGCTTCATACGGGTACCATAATTGGTCAAAGCTGACGAGTAGAAATTGCTCCCATTTAAAATTGTGATTGGGTA
TATATTTATATTAAAAAGTAAAATAATAATACCCATATCTATATTTAAAATAAAGTTAAATCTAGTAAAAATAGTACCCAATCACAACTTAAAATGGGAT
CAATTTTTAGTAGTTACGGGACCAAAGCCGAAGTCAACATTGTAAGTGCCAGTCGGTTGGTATGTGATTTACTGCATGTACTGGTCGGAACTTGTGACAT
TGGTGCGGAAGGAGACAAAATCACAATTGACTTCCCTTCCATCCGTGAGTGCATCGCAAGGAATTTTCGGTAAAGAATATTTTCAATTTCGTCCACtaca
tcctcatcatcagGATCATCTTCGCCGTGACAGCGCCATCGTCTCGATCTTCCATTTGGAGTGCCGCACAGTTTCCAACTCCAACGGATTTACCCTGGCG
ACTGTGCGGGAATTCACCACACTGTCGCACAACGTGGTGAAGGTGGCTCTGTTGCGTTCAACCAGTCGTATTGATAACTTCAAGATCGGACAGTTCGTCT
ATCCGAATTCCTCACCATCAGTTCGTCCCCTCGCGCCACTTCCAACACGCTCTCGATTATGCTTAAGTCTATCGGTGACTTGACGATTCAGCTTGTCATT
TACTCGGAAGACTGCAAGAGGAACAATGCCTTACCCGCAGTCTACCTGGAAAGCTACTACTGCGTCACTAGAAATGTACGGCGTGAACTCGGCCGTGCCT
CTCGTGGGTGGCGGCATTCGTATCACACCATTGTTCGCCACCTTGAGAGACAGCTCCAACAGAGCGAGCCGCTGCACCCAGAAGGTGTTCCTTATAATTA
TACTTCGTGAGACGTCGctactggagaagatcatTTGCTACTGATGCGGGTCAAGGAGCTCGAACTACAAGAGTAATACTTCAGCCTGCACTTCAGTCAC
GCGCTCACTTACTAATGAACAACTGGCCTAGCAGCCATTTGATGACTGTACCATGGATACGAAGCTGGGTGTTCAACGCTCGCTCACGCAGTTAGTGACG
TTGATCACTGGTTCACACGACAGCATAATGAGGATCTTTTGGGATCCGGGATCATACCAGTGTAAGGTGATCTCACATCTTCAGCgtgaagagcaggagc
actgctggagaacgggCAG