Description :
From Genome Similarity Track
Location :
Scaffold_427:148- 2543
Sequence
2395 bases(100 bases per row)
CAAAGGGTATTGTAGGACCAGGCAATGACCATTGCCGAAGGAACAGATGATTACATCGACCCGTTATCCTACAAGCGAGCCAAGTGAGACATGCACGTGG
GAGCAGGTCGCCTGACTACAGCCCAGAATTTTGTGTGCGTAAGTCAAGAGGTGTTTTGGCGCGTAGTTCATGCTTACAATAGGTTTAAGACGGCCACCAT
CTCTGTGCAAACACCGATCCCGCGAAAAAGATGTTCTATTGATCTCAATAGGGAATTCAACTATCTTTTCGCATTATATTTGAAGGATGGCTACTACTCA
TGAATGAGACCGATGTAGCCAATACGGCAATTACAAGGGTTAAAAATGCACCACCGACATTCAACCGGGTGGTCGATCACGTTATGCGTCCACACCGTGC
CTAAAGTGCCTCATTACTCTGACGATGTGTTCGTTCATATAAAGGTCAAGGACGAATTGAGTGAGACTGAAGCACAAAAACATCATTTGGAAGTTGTGTT
GTAGACGCTGGGTAACGCCCAAATGTACGTCGACTTGCTAAAGTGCGTCATAGGGGTTTCGAAAATACATGTACTGGGCTGCATCGTGGGTAAACACGGT
GTTAGATCAGACCCAGAGAGGGTTGAAGCTATTTAGGGAATGGCCGGTTCCACGACATGTGAAGGATCTGCGTCAGCTCCTTGGGCTTGATAACTACTTC
CACAAATATAGCAATAGTTACGCAGGGCCAACCAAACCAATGTCTGACCTCTTAAAAAGGACGCAGAGTGGACTTGGTATGAGGCTCAAGTAGATGCTTT
CAATTCAGTGAAGCAGTCACTTGTATAGGCTCCGGTCTTGGCTTTGCCAGACGCGGATAAGCCCTTTAGTGCTGTCTCCAGTGCGAGTACTTTCGCTACC
GGCAGTGCACTTATCTGTAAGGATGATGACGGTATTGATAGTGTCATCTCGCATCAGTCCCGACATTTAAAGGCTGCAGAGCTGAATTACCCCGTGTACG
ACAAGGAGCTACTTTCCGTAGAGTATGCTCTTGGTAAGTTTCGATTGCACCTATTGGGCACCGAACCTTTTGTAGTTTACACAGATCACGCATCATTGCG
GACCGCGATAAACTCGCCGCATCTATCACCTGGGATGACGAGGCGGCTTACATTCTTCTCAGATTTTATTTGTCGAGTTGAATACAAGCCGGGGAAGTCG
AATGTCTTGTCTGACACGATATCTCGCAGACCGGACTTCGAGTAACGAAACCTTGAAGACGTGTCTGGTGCTGACGTACGAGTTGAGTAGTCAACACTGG
CAGCCTTACGGATTGACCATGTGACAAACACTCTGGCCTCTGATATAAAGAAGAGCTACATGCAGGACGAACGTTGTCGTCTACTTATAGATCACTTTGG
TGAACGAAAAGTTAATCTTTCGTCACACTTATGGGCGAAGCTTAACCGCTTTAGTTATAGTGATGTCCTGTTATGGCATCAGCTATCACCCTGTGATCCA
TTGAGAACCTGTGCCCCCCGTGATACAGATCTCAAACAGAAGATTCTCTACGATCTCCATGATGCACCATCAAGTGGTCATCTGGACCGTGAGAAGACAT
TCTTACAAGTGTCAGATGAATTTTGGTGGCCACACTATATAGGTGGGTAGTCAGTTATATTCGATCATGCGAAGAGTGTCAGCACGTAAAGCCTGCACTT
TCTAGTAGTGCGCCACTGAAGCCACTACCGATACCAACTGATTGTTAGAAGTCGGTCAGTTTGGACTTCATGTTGGAAATGCCGCCTGATCATAAGGGCA
GGACTGTTCAGGTCGTCTTTGTTGACCGACTGAGCAAAATGGTGCATTTAGCACCGTGTAGCACCAAGATCTCAGGGAAGGAGGCAGCTTTCTTATTCCT
GGATCACGTGTATCGGCTACACGGGATGCCCGAGTCCATAGTTTCGGATCGGGATCCACGTTTTACGTCAGGGTTTTGGTGCCATGTGTATGGGCTGCTT
GATAGCAAGCTCCACATGTCTACCGCCGATCATCTCCAAACCGATGGCCAGACCGAAAGGGCCAATCGTGTTGTGTCGGATGTATTGCGCACAATAGCAA
CTACCAAGGAGTGGATCAAACATTTACCATTTGTGGATTTTGCTATTAACAACAGTGTTCTCGCCAGTACGGGTGAAACACCATTTTATGTGAACGGACT
GCGCCATCCTCGGAAGCCAGTCTCGTTTGTACGCAGCCCGAGTCTTCGTGGGGAACGGCCCCTCACAACGCTCGGAGCAAATGCGGAAGATCGTAATGGT
TTCACCATTTTAGATGGCAGAAACTCGCTCTAGTGACCCTTCTAGTGTTGCAGTGGTCACGACACAAGAGAGTGTCAAGTCGGATTCACGACACA