Description :
From Genome Similarity Track
Location :
Scaffold_1691:148- 2427
Transcript NameFunction/comments
Phyta_totarag13509hypothetical protein

Sequence
2279 bases(100 bases per row)
GCGTAGTTCTCCAAGTACCTACACAGAAAGGCGGCAAGTCCAAGGAACCGCTTCAGTTCCTTGACTTTGGATGGTTCCGGCCATTCATTGATCACTCTAA
CCGTTCTCTGGGTCAGGGCGTACGCCGTTCTTCCCGACGAGACAGCCAAGAACGAGTATCTCACTCGCCTCGAAGATACGCTTCTTCAGGTTTGCATAGA
GCTCGTGCTTACGCATCAGCTCAAACATCTTATGGCGATGCACCTTGTGCATCTCAATGTCCGTCTTCCTATTCACAGCCCGGTTGTGAacgaacacgtc
gtcgaaatAACTCGGTGCGAAGTCACGCAACAAGTGCGTGGCGAACCTGTTGAACGTCGTAGGGTCGTTCTTCAACCCCTGAGCCACTCCCAAAGTATGT
CACTTGGCGTGTTTACCGCCGTGAGGGGGATGTCGCTCTCACGCATCTAGATCTGATAGAATGTGTGTCTCAGATCAAGAGCACTATAGATGGTGCTCAG
GGCCATCGAATCGATGATCACANAGTACTTCGTGCCCGGCACGAGGTCAATCTCTTGCTGAATTCCCTTGTCCTACCGGAGCTCCACAGGGATGTCATCC
GGGAGTACATCCTTGTACTCTCGCAGAATCTCGTAATAGGgactcgacttgagcgagtcccaactctgctcttcgaagcgctccttcttcttcttggcgc
tgagaGTGTCCTCACTCTTATTGGTACTGCCAGCGAAGAGTTGCTTCAACACTTCCGTCTCACACTTCAGCCTTTCACTGTCCGAAAGAATGCAAATCTG
CTCGATGTGTCCATCGTGCAAATCACGCGTGAAGCGCTTCCTGGTCATGACGTCAACTCCGATGAACTCGCGGAAGGGTTATCAGGCGTCATACTCCTGT
ACTGAAGCCCAGTACAGGTCTGCGTCAAGACATTCAGTGTCTCGGTCCCGGTCTAAtactcgcgcagcttctttTACTTGCGCTGtcgtttcttcttctt
acGGAGCCTGGCTCCGCGTGATCCTCGTCGAAGCCCGGCCACGGCCGGGTTATCCATGTAGTCGCCGGCAGTTTCTATCCGCGGGCGGGCATCACCCAGC
CTCACATAATGTGCATGTTTCGCGGCTTCGTGTAGCCTTGTTGCACGTGAGTTTGCAAGCTTTTCTTGTGCTGAACGTTTACAACCGGCcgcactgctcg
cagcgcCAAGTCCCGGAACTGACGCACCTTCGTCTCCTCGACGCCTTTCCGCGGAGTTTACGGCCGAATCTGATCCAATCAGAATCATGTCAGCTCTCAA
AGCCGGCTCGTTGCTGTCACAAGGTGCTTTTGTGGCGGTATCACACTTTAAATCTGATTTTATCAGCTTCTCAGTGGCATTTCCCAGAACCGAAACAAAT
TCACATTCAACGACTTCCGATCTCGTCGGAGCTTTGCACATTCGTGCCCTGCGAGTCGAGACAGCAGCGTTTAGCGCTGTCTCTACAGGAAGGTCGCAAG
CAACTCGTGATGCATGTGTTGCGCTGGCAGGGTCATCGTTCACTGTCGCGCTATCGCTACCGAAGCGTACAATCGTACGCTTCTTCTGGTCCACCTTCGG
GTCATGCCGTGCAAGCCACGGCATacccagcaccaagtcgaacttgtcgtgtAAGGCTAAGACGATAAGGTCCTCAACAAATTCCTTTTGTTGATACGAG
AATCGTACGCGTACGATACGCTTCTCTGTCTTGGCGACGACACCTGTTgccagtcgtacttccaatACACTTCGAGGTGTTTGCACCTCCTCGTAGTCAA
CAGTAGGTAGATTTTTCAGCCGAACAAAATTGTTCGACGCACCGGAGTCTACGAAAGCACGAAGAAGGTCCACTCGCTTCGAAGTCACGCCCAGGACGAC
AAGGTTTGGCTTGTCATCTCGCTTCTTGAAGTGAGGTTGCCTCTCATGGGGGACTACAGTCCTCATTGACGCGTGTCCAATGTCGACATGTGTGACTGAT
TCACCAGTAAGACGCCCCGCCCAGCTGATTCCGTGcgattttttttattgatCGCAGTGATGccctgcatcgccacgttgACCTCTTTGCCCGTGCACAG
GTGCTGTGCAATCGCGCGCAAAATGATCGATGCGTCCGCAACGGATGCATCGCACTTCTGCCTCAAGacgtggggggggggggggggggggtcttcCCTG
CCGTCGCATTAGAAAAGTCCATTGCTCTGGATCTCTCGCCCTTATCACCAGACGTGACATCCTTGGCACGTTCCCATGC