Description :
From Genome Similarity Track
Location :
Scaffold_418:148- 2033
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_418-snap-gene-0.5Complement control module protein

Sequence
1885 bases(100 bases per row)
GGACCCCATCTTCTATACGCCTTGGCTGCTGCaTGTGTGACCACCATCATAACACTTGGCGTGGCAGTagCTCGGcGaCctCGTTTTTTtCGCACAGAGA
CGTACGACGTGGTGCTCACTCCATGTTAAACACTCTGtGTGGAATGCCGACTCGCTTTAGTGCcATGCAAATCTGATTACTGAATGTTAGCCGGATTTtG
GGGGAGAAGTTGGGCATGCAGTTATGATGTGTTAAATAACATATGTGACGTGTGAAAGAGTTGTGAGTAAATGCACCAAGTTACTCAGTTCGAGTACGCT
TTGGCTCCTTGCGCAGCTCGTACACCAGCCCAACTGATCTAATGCGCTTCCGTCCGCATGGATCGTCGCTGAGATACTCATGGCACTGCATACAGCTTCG
AAAGCGGTGCAGGCTTCTGCGGGCGTCATCCCGCGTATCTTGAATCCTCGTTCCAGCGTTCGCACCTCAAGTTtCGTCATCAAAAAGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATGC
CGCCAGCGCTCGGCTACCGCAAGTACGTATTCTGGACGCCGGCAAGTATCCAACCAGCGCACAGATAAACTGCAGTGGATGATGGACActgtatctaCcc
TGAGGGACAGAATGTCACGGCTTGAGTGGCTTTCACGCCGATGTCCATTCGGTCGAACTCTGCATCCATCTGCGCTGCTGTTATTGCTGTTATCACTAGC
GAtaCCAAGGCTCCTTGTCCCTCAAAATCAAGATGATAACCCGAGTACCAACAAAAACTATGGAAAAATGTATACGTAAACAATTTTGATCATTTTGTTT
TTGAGGGACAAGTTtCTCACAAACCGATCGCCAGGGCCTACTTTTGTCCCCCATAATCAAGAGAATGTATTTTAACGTGTGGATAAGAACCAGAGGCAAG
TGGGTCATCCCTTTGTCTCTCGAGGACGAGGAGGGCATGCTTCTGCATGTGTCAATCCCCATTCCTCAACTTTACTCTCCTCATCAGCCCCTCGAGCGAT
GCGTGTCGCCGTAATACTCGCCGTTtGCGTCGTCGGTCTACTCGAGACCACGGAAGCTGCCAGTTTGAGAGGCGGTAAGGCTGGC