Description :
From Genome Similarity Track
Location :
Scaffold_323:148- 15140
Transcript NameFunction/comments
Phymu_g8594hypothetical protein
Phymu_g8595hypothetical protein
Phymu_g8596DEAD/DEAH box RNA helicase, putative

Sequence
14992 bases(100 bases per row)
GATGCTGCAGGAGAGTTTAGGGGGAGGAGAATCTGCTGCTAGTGCCAGGAGGGCCCTTGTCCAagtgcagaagctgttgcagcttgcGTCTGTCAGGCCC
AATGCGCTGACCCTACGTGAATATCGCGAGGGACTAGAGGTAAGAGGACGTTCCTTATAACTTTTACAGGTACACAAAATAACTTGGTGCTATTTCGCAT
CCTGCAGGAGTGTTTGAAGTCCGAAGGAAGCGCTACAATGAAAGTATTAGGGTTCCAActcgctgcaattgctcctggctgctgcacgtacgaAGCCTGG
AAGTTTGTTCTGGAAGCGGTGGTGACGGAGCTTGGTAGTTCGGAGAATCTCTCGGCTTTGGCCGCTGCGGTTCCCGTGCTCGGGAAAGTTCCAGTACCGC
TTCTACTTGGCTTCCTGTTGTCTCCTGAAAGAGAGCCCATGAACAAGCTGCGTACACTTTTGACTCACGAAGACATCGAAGTTCGTTGTAGCGCTATTGA
GACGCTGTCAAAGTTAACGATAGATGTGGCTGTAAACGTCGTTGGAGACGGACTATTTGTCTTCCCATTCGAGTCTCACGAGGCTCGAATTTGCTGTCAA
CAAGACTTGGAGACGATGGTCAACGACTGTTGGAAGTTGATTTTCCACACTCTTTCGTTTGACGGGCAGTCTCAAAGCGCTGCGTGGGCTGCGGGTATTG
CGTTCACGGCTTTAGCAACTCTGTTTGCACgttccagcacgttctcGCAGTTTTTCCCAAGCATTCAAGACGCTAGCCGCGTTCAAACGCCCATAGATGA
CGTCACATCCATGATCTACAAGCAAGCATCCCCGAGAGTTCGAGTCCTGGTTACTACAGCTCGTAGTCTTCccgtgaagcagcagccagacgCTTTACTG
TGGATCTCGATGCTTCTTTACACCATGATGGAGCACAGTGGGGCGCGATGTCCAAGTGTAAGTCGCCCGTACGTGGAAATTGACACTGAAGATAACAATG
CTGATAGTAtggacgatgacgagtcTCAAGCTTCCACGGAGCCTGTTCGAGTGGATGAATTGGTGAATGATCTACTCGAGTCCTGGGCATTTCCTACAGT
ATCACGGCGGGTTTCGCTAGGCCAGGCTACTAGTATGTGCCGTGCCATCTTCATTTTGCTGGCACATCCACTTCAGACGTTCACTCGTATGCGCTGGGCT
GCTCAGCTCACCAACCATCTGATCGCCCAGTGCTATCTCGCCAACAAGCGCTCCAATCCTGAGCTGAAGTTCGAGCTTAGTGTGATGCTCGTGAAGACGT
TTGCTTGGCTGTCTGGAGTCAACTGCCAGTCACTCTTCGTTCGGACAACGGAAGCTCTTTATCTACTCGACCAAGAAAAAGATCGACGGGATCTTGTAAA
GAACCTGATGGATACCATCGCCAAGCACGTCATCGCAAGCCGAGACTTTCAGCTACTCCAGGGTTTGTGCACAATGGCGTTCTTCAGACAACCAAAGGGA
TTTTCTAGGTTATCCCCACGCACGAACGGTTCTGAAGTGGTCCGAGCTCTTTTCCAAGCTCTCGCCAATACGACAGTACGTCGAGGAGCTATCGAACAAC
AAATCTCCCAGCTTATTGCCTTGAGAGTTTTCCGGGGGCTACTTCTCCTGAAATTGGGCGGGTCGGCTACTACTTCCCCAAAGGCGTACCGTCGGTCCTG
CGAGATGAGCGAAAACATTGTTTACTACACGGGTCTGCTGACGTCTCATTTCCAGGGGATGCTGGCTTGCCCCCACCTTGCTCTTCGTGAATCACTCGAC
TTTTTCCAGCAAGAACTGTTCCCAACTATGGACCAAATTGCGTCGCAGTGCGCTCGTCTACAAATACTTTGGGTTGgtgtgcagcttcatcgcaATTACG
CCACACACGTCTCTTTTGACTCTCTCGtacgagagcttcagcgcGAAACCGGTCGGCTTTTCACTGCAATTTGgaatgacgaagacgaggtGGAAGGTGC
AACTTTCGACAACGGTTTGCTTGGCAATGGGGGAACTGGTGCAGAGGAAACTCCTGCGAGCCGAAAACGTGCAGGAGACGTCAATAACGTTGACGCGTTG
ATGGTTCTTGGTGATTGTATCACGCTGTTAGCACGGCTTCAGCCCCAAACGCAATTGCAATTTCTCCAGATGTGTGAGAAAATGGGTGCTTCGTTATCAG
CTTCCGGAGGCTCCCCAGCAACGACATCCCAGCAGTATCGTGTGTACGCTTAGTATGGCTTCATCTTTGCTTGCAAGCTGGTAAACTAACCTTCTATGTC
TGAGCAGTATTGAAGATGTTATGGCACTCCTCTCAACCCCGTTATCAGCAGATTCGCCGGCAGAAACCGAAACTTCGCTTTCAAAGGAAATATTCGACCC
AGAGGATATTTTTCTGCCACGAAAAGATTTTGATACGAGCAGCAATGAAGAAAATCCGCACGATGAAGAATTCCAGGAGCCGATCACTGTAACAGGGAGT
GCTGATCCTGTATCTATCCAGATCTCTCACCACCACCCGATGTCTGGAAAGGAAGAGATTGTTGAACTTGAcatcagctgctgcaacctCACTACTTGGG
CGTTGAACGACTTAGAAATTCACCTTCGCCCGCTTGGAGGTGTCGGTGTAGTTCAGTGCGTGGACGCTTCTAAGGACTTGAAGTTACGTCTGCTACGTGC
TGGTGAGACTGTCAGCGTCGGCACAAGCGGAGGTTGCACTAGTTTACCACCATTTGGCGTGATCAAAGCCCACAAACAGTTCCGCGTTTGCAAGTTTACC
CAGGCTACAATTCTGGTGCAAGCAGTGCTCGTTCAGGACCCTGTTcaagacaacgacgacatGAGCGGTAATCCAGCAGAGGAgccttctccaactccgA
TCCGACTAGCATTCAGCAACCAATACATGCTCCATTTCGACACGCTCCTTCGACTCCCACAGTCTCAGTTTGCGACCGCCTcgttcttccagcacttATG
GCAAAGGTATAGCGTTTTACCCTAAATGTTGGTACCATCTCACCTGAACTAAAAGAAATCTTTGCTCTAGCGCTGTCTCGAGTGCAGTGTGGCGTGTCAA
GTCGCAGAGTTCACCTGGTGGTAAACTTGGCGTTTATCAGCACGCGCTCCACGTTATGAACTCAaagctggctgctgtggccgaactgctcctcgagctt
cCAATGCACTTCCATGTACGCCTCCCTGTTTGATACGCTTTGAATTATGTACGATAATGTTTCTCCTCCGCATTCTTTGTAGATCGCAATGCTCTCTCAG
ACGCGATGGGGGTCCTATGTGGTCGCAACGCTGACAATGAGCCTCGAGTCGGATTCAAGCTGGTCGGGGGTTCTGGAAGTACGGTCTTCTGTCGATAATA
TCCGCGAGTTCGAGAAGTGGCCAAAAGATACCGTTCGTCTCTTTAGTGGAGACCACGTGCAGCTCTGCAGTGCCCAAGCGACcccatcaagcagcagaca
aaCATCCACTTCTATTGACTCTTCTACACCCCAGCCAACGCCATCTCCATTCGATATCCCTGCTCCTACGCAGTTTATTCCTACTGAGAACGGATTATCA
GCTGGAATGGCTCAGGATCCGCCTACGACCGCAGCTATTCCGACATTCGCACCGGATGTGCGAGCCACCACAACCCTCCACAAAGACGTGAGCATCCCCA
CCGACCGCATTTCCTCCTTCGCACGCAGTAGCCAACAGCCAGAGCAAACGCGCGCCCCTGAGGCGACTCCGGCTCCTGACGAGCAGTGGGGCAACTTTCT
CTAAGATACTTgaagcaagttgaaggcaacttcaactcgGTGGTCGTAAGATCTCTGCCCACTTTTCATTGGTTAAAATACCGTTCAATCACTTTTCTTG
CATCAGATCTCCATAAGATGCCGCTCGACCGGCAGCGCGCAGCCCCGGGCAccgcttttgctgctgaggGAGAGCGCGTTTACCGCccgctgctgttcca
gtcCACGGGTTATGCGTCGTCAGAGCTCTTCCGAGACTCGTACGAGATGCATTCGCGGCTGCCGACGGTGTCCTCGACCGCGCCTCTGCTAGGGGTAGAG
ACTATTTCCACAGACTCATCAGAGAATCAGAAACAGAGGCATGCATTCGAGCCACAGATTCGACTTGAAACGCTGTCATCAAGAGCTGCTACAGCGGTGC
TATGGGTCACGTACATGGCGTTCTTGCTGGCCATGGCGCTACCGTATCTGCAGAGTAAAGGGTATCTGGAAACGGTGCGGAAATGATAGCGCGGAACTAT
GATTTTAGTTGTTTGGTTCTGATTATTATACTCTTCAAACTGCAGGCAGTGGAGTTGTCGGGGGCCGTTTGTAGGGACGAGCAGAGGAGCGAGCCGTGCA
TTAAAGTGGACACAACGAGGGGCATTGCTCAATGGGCAGCCTACGTGGCCAACGTATCACGCTATACAGGGTCTATTGAGATTAAGCTTGACGTTCGGGA
GCAGGTGAACACGTCAACATTATCAGatttgctgtcgtcgctgacGGAGAGCAATACGTTCCAGGAGCTCGAACGCGTGGGAACTGCGTGGAATATGAAT
CGCGATGTAACTAGAGTGAAGAGCAGCTTAACGAGTCAAGCTTCAAGTATCTCCGAGCTTGAGGATGGAGAGGTTGACCATGATGCAGGCTACGTGTTGA
CGTTCGATGCCAGACTTTATGGTATCGATCATGACGTCACGCCAGTCACAAAGGATCTCGTTGTGGATGAACACAATCAGAGTATTTGGGTGGAGTGCCG
ATCAGGAGGACCGTGTGAAGTTGTGAGGCTACTGGAAATTACGCAAGACGTCGACCTATTGGTAAGaatgggggggggggggggtatGAGTGTGTTTTGG
CTTGACTAATTTGCGTTTTCTTGTGCAGGGAGGGAGTGAATACGACGCGTACTTTGCTGTGGTGACATTTAAAGGACTGTATCCGAATGTGTTTGGTAAA
GAGGTCTTCTATCAGTTCGCGTTCACGTACGTAGTGTTTGATACTGCTCATTTCATTTCAGTGAAAAGCCTAACCTAACTTGCGTGATGGTACATTCCTC
AGAAAGCCTGCCATTCACGTGGGTGAAGTTATTGTTCGTGGTGTATTTGTGCTGACGTCAATTTTGGCAATTCCTTCCTGGTTCATTTCGGTGCTAAATT
TCCACTCTGGGTCGTGGAGTAAAGTGTTGACGGTGCAAAAGTGGTTGCTTGGGGTGGGTATCGTTCTTTTGCTGTGGCAAAACCCAGTATACGCAATATC
TGAGCTGTACACCACTGTGAGCTTGCGCACTCGGTTTGTATCCATCACGTGCCAGTCGTTCGCGGAGGCTTTCTTTTACGTATTTTGGTTGAGTCTGATG
GATCAGCACGGTGGAGATTTTTCCTCTCGGAGATGTTCATTTGCAACAAAATTCGTTTTTGGGCTAGTACTTTTTGCAGTGGACACCGGTATGACAGTGC
TGCGGATGCCAAAGCTATTTTTCGGAGTGGAAGGGATATCAACTGCTCACGATTTTCACCACGAAGAAATTTACGTACTTCTCGGATTTATTCGTACGGG
ACTGGTGCTCTTTTGGCTTGTCTGGATAATGACAGTTGGAGCTCGATCGGGTCGGCATCTCAAAGCACTGCCATATATGGCTACtcgcttcaagcagctg
tCGTACCGATTCCTCGTACTCGAGACGCTTCTCATTTTCGTCTACGTGCTTGTGCTCTCAGCTCTCCAGATATTTTATCTGACCCGAACGTGGTACTTCG
TAGGCTACGATGCATTTATACAAGACTCGGTGCACACTTTTGCCAAGATGCACACTGGCCACCCATCATTAGGCAAGTTCCTGTTCCTCTCGGTGTATGT
CTATTTGGTCATGTTCGTGCACTTGCCTCCACTCGCGGGTGACAGTACTGGCCTAttggcttcaacagcttTCCACGTTGACGAGAAACCACGCGTGGAC
TCTTACGGCTTCCTTACGCCGGATTCCAACTTGTTTTGTGTGGAAACGGCGGGATGGTTATTGGAGTTGGCATATCAAGCCTATTTCGACCCCGCTGGAT
GCCCCTCAGCATCTGGATACGGCGAACTCACGCTTGAGCGATATGGTTTTGAGCTGATCACGCATTTGCGAAGCAATCTTACGGATACACATGCAGTCGT
CGCGTGGAGTCAAGAAGACCACCAGCGCTTGGTCATATCATTTAGAGGCACAACAAGCAAGAAaaactggaagagcaacCTTCGCGCCGATCAAAAAGTG
TTGTGGATAAAGTCTCGAGGGCTGCGTTGGAGAAAATCCTGCCTGGAAAAGGTGAAGGATGTGGCAGCAAAGATCCCCTTGCTTAACATGGCGCTGCCGC
GGGTGCACCGAGGTACAGTGACTCGTATATTGCCTTGTTTTGTGTGGCAGGAAGGTAGTTCTAATTTGTTGGGTAATTTTGCAGGATTTTGGATTGCCTA
TGAGTCGATCCGTGACGAACTAAAAGAAGTGACCCGCCTCATTCTGGATGAAAATCCCGGTGTGTCGGTGTATGTCACCGGTCACAGCATGGGAGGCGCT
CTTGCAATCATCGCTGCGTATGACCTCGCAGTAAATTTCAGCATCAAAGTCAACATGTACAACTTCGGAGGTCCTCGTGTTGGCAACCCAAGCTTCCGCC
AGCACTATGACAGCTGTGTCCCCACGAGCTACCGAGTTGTCATGGACGGAGACATCGTACCGGGATGGCCGAAATTTGTACGCATACATTGTTTGCAGTA
GAATTCCAGAAATGATTTACTAACTTTGCTATTTGTTTTTGGTTCTAGTGGGGGCTATACCAGCACGTAGGGACCGAGATCTCTCTCGATGTGGCAGGTA
ACGTGATCGTTGATCCAAGTTTCGTCGAGCGGCACCTCCACAACTCTTCGCGACGCAAGACCACGATGCATGGCACAAACGTATATCGAGTGTCGATTGC
AAAGTGTCTCGAAAATCTAACATCTTCGTAGCAGCAGTGCAGAaatctacatgtatctaTTGCACCATTCACCCTGTGATGCCTGCTGGGAAGCGTCGCA
ATCCGTTTCGTATTGCTGTTGACCTCTTTTCATTGTTTAGATAGTTcggcgctgctcaagcaTCTAAGCGTTATGGACGGAGACGaccagcaggaacagg
aaggTGTGATTCGCTCGCACATTGACCTGGCGGAGGCAGCGGCCAACGGTTCCCGTGCAATGGTAAGTCATTTATCTGCACTACAGATCATTGGTTTCTA
ACAGGTGTTCCACATTCCCCAGGTTGAGTTTCTGTTGGACAACGGCGTGCACATTGATACACCCGGAAAAGGTACCAAATTTCAGGCTAGAAATGTTCAT
TTGTGACGGATACGCTCATTTCATTGTCTTTGAATCACTTGCTAGACGGAACGACGCCGCTatgcgctgcagcactaTGGGGAAATGACGCCATGGTCAC
ATACTTGCTGGAGAAGGGAGCCGATGTGTCGGCTAGAAATGAAGGTATGGCAGCATTTAACCTCTTGAGAATGTAACTGCTGGTCAGACTAACAATTGTT
TTAGGAACAGGGTGGACAGCGCTGCATGCAGCTTCATTCCAAGAGCATGGAAAAGTTGTTCGCGTCCTGTTGGCCCACCAATCAGACCCTAAAATGGTCG
ACGTCGAAGGGCGAAGAGCAGTGGACTACGCCAGCATTTCGGAAGCAATTTGGCCCTTCTTCTCAGGTATTAGCCGGAGCGTCTATTAACCGTCCATTGC
GCCTATTAAACATCGTTTTTTGTTTCAATTCGACAGCGCAAGGCTGCACCAAAAGCCTGAAGTCGGACCTAATTGCCAAAGGAATCATCCGCAAAATTCC
AGACCAGCCGGAACAGACGAACGATAAATACGACAGCGTACGTCCAGTAAGCAGCAATTTAGTCGTACCGTGGCTCTAACCATTCACTTTTGCAgatctc
gtccttctcgcgTCCTGGATCGGCCTACACAAGAGCGCAAATGTACCCACCGCTCGTTCACCGACAAAGTCCCGCCGTTAAGGTGCGCTAATCCCAACTT
CACTCAGCTATTTGTAATCTAACACTACCCGCTGCTCTCAGTCTCGCGATGGCCGCATCCTGACGGGACCCATTGACCCACTGGGCGACATGCCTGCCGA
GCCGGAGTCCAACCAGCGAGGTCCGTCTCTCAAGAGAATGGGCATCTGAATAGGCAAGTCAAGTTGCCGTTGTTGAAGTGCGCCTGAAGTAACAATTTCT
TTTCGACCAATGAAAGACAGTCAACGCATCAAAAAGAGCTgttattttgtaagtatgATGTATTCCGTTTGGCAGGTGCGCTATAGAAAAGTAGCCCTTG
CGCCGATGGCCGCTCGTTTGAGAGCCCCCCTCGGCCGCTCAGTTCTTGTATCGCTTCGCCGCCAGCACGTCGTTCTACAATGGTGAGGGCCAGCACCGCC
GGAAGCGCCACAGTTCTCAGTCTACAGACAGCTAATCCTGACTGTTTCTCTCCTATGTACTGTTCGTAGTCGCTTCTTAACAAGGGATCGCGTCTTATGA
CCCAGTCGCTCCGCGCTGGTGCCCGCAACATGTCGAGCGCCACCGagcaggaggccaaggagcaGATGCACCGATGGACCACAATCTCGAAGGGCATGAT
CGGCCTGGTGGCGGTGTACACGGTGTACGCAATCAGTGACCACTTGAGccacgagcaccacgaagaggagaagcccGCCTACCCGTACCTCAAGATGCGC
ACCAAGCCCTTCCCGTGGCCGGAGTCGGACTGCGACCTCCTGGACTCGGAGTGCCGTCGCAAGGCTCgcgaggccaagaaggctcTGGAGTAAACTGCAC
GATATCAGTCTTAAGGTGGACCCGGTGCAGACTTACCAGACGCAGGAGAAAAGGATGAGTTGACTTGTCAGCTTCCGTTCTGTTCTTCTATCTGTCGAAG
CTGGTGTCGGCTCTCGTCGTTTTAATTCTCCGGCTGGTGTCATTTCCTGTTTGCTCGGAACTCtaaatacttcgaagtactccGCACACACATACAAACG
gaaaaaaagaaaataaaAAACACGAAACGGAGTCATCGTCGTTGTTATTAACTTTTCGATGtgtattacatgtactggaAGCGTTAACGTACCCTACACG
GAAagcaagtacatgtataatactATAACATGTGCGTGCGTAGTTCTGCCCTCGCTCATGttccagcaccgccagtACTGAGTCCAGCATTTATACCACG
AAGTAACAATATCGAGCTGGACCACCCGCAAAATACCGCTACTTCTCATAAATAAATACTTAAGTAACAACAAACAAAATGGCTGACTCCGTCGTAAAGC
GCAGCGCCGACCAACGCTATGCTCAGCCTGGCGAGCCCACCTGCACGGTCAGCCACACACAAATACTAAGATGCTCTATAAAGACAATGAACCTAACACA
ACATTGCCATTGAACCTGCAGGTGTGTGGTCGATACGGCGAATTCGTATGCGACGCCACTGATGAAGACGTCTGCAGTCTCGAGTGCCGCGATATCTGCG
TGttccgacagcagcagagacttCAATCGAGCCAGCAACAAGATGGACGAGCTGACGAGTTACGATGCGAGTTGGGTATCAACATCTCAATCAATTCAAC
CTCTGGGACTGCAGCCAGGAGCTTTTCAGCAACTCGATGGCCGGTTCCAATCGTGGAATTTGGTCAGGATCAAGAAGGCGTGGAATTATGCAAGGAATTG
CTGGATAACCTTAATGCCAATGGCTTTGACAGACCGACGCccgtgcagatgcagacgatCCCATGTGTGCTAAAGGGGCACAATGTACGTGGATTAAGAA
CTGGTTTAGATTAGATTTACACAAAAAATGCTGACTTATTATCGGTAAGATGTTGGTGAGTGCACCTACAGGGTCGGGAAAGACGGCGTCGTATTTGGTT
CCAGCGATCACGCAGTGTTTGCTTGCACgggagcagaaggaggagattctgacgctggtgttggcTCCTGTTCGAGAGTTGGCGATTCAGATCGAAATGG
TGGCGAAGGCGTTGATGAAAGGAATTGCTGGTATGAAGACAGCACTGTTAATTGGAGGATTTCCTGTCCCTACGCAACGCTACCGTCTTCAAAATGGGGT
GCAGGTGATTGTAGCAACACCAGGTCGCTTTCTTGATATTTTTACGAACTACAGCGGTGGAGACTCCATCCTGCCGGACATTCGTACCTGTGTGGTTGAC
GAAGTGGACACTATGCTAGACGTTGGATTTCGACCCCAAATCTCTCAAATTGTGGCTTTGCTGGGTGGAGAACGCAACAAAAATGTTCAGCTGGTGTTCT
TGAGCGCTACAGTGTCCCATGAAGTGGAAACCTTGGTGCAGCAGCTATTGAAGGCCCGAAGTGAGCAAACGTATGTTCGCGTTGATGTTCGGGCCGATAA
GAGCAAAACAGGCGAGAACTTTGAGCTAAATTCAAGTGTGAGACATCAAGTTCGATGGTCAGACGACAAGGCaaagaagaacgagttaTTCGAGTTCTTG
AAGGGGAAAAGTGAAGAATCAACGGTAGGTCGATCTTCTCTACACTGTATTCTTTATCGATCTAACTCAGTTACTGTAGCTTGTCTTCGTCGGGTCAAAA
GTTGGTGCAACGCTGTTGGCACAAGCTATCGAGAAGCGCTGTGGGATCGGTGCAGCTGCAATTCACGCGGATAAAACTcagcaagagcgactgcgTTTGC
TGGAATCATTTGTCAACTTGGAGATCCCGATTCTTGTGTCAACGAACGTGCTGAGTCGTGGTATGGATCTTCTGAACGTTGAAAACGTGGTGGTCTATGA
TTTCCCAAAGAAGGTTGCGGACTACGTTCATCTCATTGGCCGTGTCGGACGAGGTGTCGATGTGCTTGGAAATGCTCTTACACTTGTGAATCTGGAAGAC
CGTCCACTTTTCCGAGAACTTGTGCCACTGTTGCGCCAAGCTAAAGTGTCAGTACCACGTGAAATTTACCAGAATATCCGCTCAGAGGACGTCAAAGAGC
GTGTTCGATCCAGTGATAAGGTGGTGGTTGATGAATGCAAGCGGGCTTTTCGATTTCGGGAGACACTGGTAGAAGAAAGGGGCTTTCAAACATCGGACTG
GAAGGAATGGGAACAGCACAATAACAAGCGGAGACGAACCCGACCGTGATCCGGTTACAAGTTCTTGGGTGTTCCATTGTCAAGCAATAGCGCGGAAAAT
ATGGGCCCGCGTTTTCTTCTAAGCACTGCAGGGGCAACTCGATCTCGTGATTTATGTACATTCACGACAGCTCGCGAGTATTGCCGTTTTCCTTTGGAGA
TGTAGTTATTGTAGCACACAGCGCCACGGATAATGGCGACCTCCGTCTTTGACACTATTGTGAACCGCCAAATGAGACGTGGACACCACAGTGCCAGCGT
CACGACCCGACTGAAGTAAAATGGCATGATACGAACGACTACTGGGTGGTTCCAAATAACTGCTTGGAATATGACGGTATCCTTcagagcttcatctccg
aTGAAAAAGATGCGACTCATAAGCACGATGTGGGCTAGAAGCAATAGAGCGGCCACGGGAGCTGCAAACTGGACCCGGAAGCGTAATTTATCTTTAATGA
CGGGCGTGAGAGCATCAAGTGTGAGAGACCAGAGAAACCAGAGCTCCCAAGTGGCCACCATAATACAGTGAGATGTCTCCCATCCACTCAAAATGCACAC
ACTCAGATTGGCTGCGGTAATCTGGAAAGCGTAAAATAAAAAGTCGAACGACGTGACCAGAAGCCTgagaagctgacgctgaTAAAGAGTGACGAATACG
ATTATGAAGATCAACGTCCACAGAAATGCACACCACGCTTCGAAGATCAAGACAGCCCCACTCAAGCTGCCTAGAAAAACGGAGCACGAGAGGAGGAAAc
ccacagcaccagcagcgtaAAGTGGAAGCAGATACCAGGCTGAATAGGAACCGTTGGGGATTTGTTGGGGGGAAACTACGTGACTGGCGTTGAACACATG
TGGAGACTTGACGAAGCGCATCTTTTGAATGACCTTCGTCTCACGCAGCGTCACCTTCCTGTTTGCGCCAACTCCACCACGACGAACATTTGCCCGGCTA
ACGTGATTTTTGGTGGAGTTTGCGTGTTGAATTGGCACCAGCTGCAGAGGACATCGGTAAATTACACAATGAAGAGCTGATCCCTGGTTCTTTTGCAACG
CTCTTCGCTTCCTCACTGCAATTTTCGTGATGAAAAGCGCGAGTGTCAGCAGTCCATTGCCGATTATATCGACGCCAGAGAGATGGAAACTGTGGTGCTC
ATTCTCGTAATTCAAGAGTGAAAAGCTGGTACAAGCATCGATGTGACCCAACATGATCCACACACAATGAAGAGCACCGGGGGAATTCCGATAATAGTCA
TGAGCGCAAATTGACGAACTCCTCGCACATGAGCGTCGATGCAAACGATATGATGGAACCCCACCCAGTCGATAACCATTCGAAGGCACCGCAGATCTCT
GAAATACGCCGAGACCATCCCAGCGGTCATCGTTgtgacgaaggagaagaaccagaagTCGAATGTTCCCATGAGAAGTAGCACAACGTCATACCTTAAA
ATACTGAAAGCTCCCAGGCCAAGTGGGATCCATAGGAAAATGGCTATTAGCGATAGAAACTGGCCGGTCCGCGCGTTAACTACTGCCACAAAGCTGATCA
AGAAAAAAAGCAGTCGCATTTGACACTAACAAGGGCTGGTGGTACTTTGTGAGGAGACGATGGCTAATCTCGTAAACTTTTGCTGGTAGGAGTTCTCCTC
GGAGGGACTTGGACAAGTCAATCACAGGCAGTTGCTTTGCAGGCTTGAAAACATAGAGAATATCTGAGCTAGTAGTACCAGCTGCAACGACTCTTGCCAT
CGAAAGCGTAAGTTGTCAAAGTTTTGAAGGCGTCCTCATTGCAGTCCGACAGCTTAGAAAATACCGTCCGATAGGAAATTAGTCGACAAGATAATCTAAA
TGTAGTTGGAATGAAGACTAAGAAACCAGAGTCGAGGATGGTGAAACTATGAGACGAAGTACTATCTAGGCTTTACTTATGCCAAACTTTGAATTTGGGC
CCTAATACTTATATTTTTCGTCCCTTGAAAAAGATGGAGACTATGATTTTGTCCCCCTTGGGTCCAGATAGCATGAAACGATGAAAACGAGCTCCATTTA
CATGGGTTTCTCGCACTGGAACGACGCAGCAGGAGATACTCTAGTACGACGAGAAAACGAGGAGACCAACCTCTTCAAACCAACAAGTTGAGAAATGTgt
gaacttcttcttctccctctcGTGAAGAAATTGTCGTAGCAGACTGTGCCTCGAAGAATCGACACGTCGTCACTGGATGCCGAGGCCAGTCGTACAACTA
AACGCGAGCACCAAAGCGTCAGCGTCAACGATCGACTAACGTAGAATGGGATTAATCGAATCCCCACGTGCTGATTCCAGACAGTTCCCTCGAAAATGAC
CGTATCTCGCAGCTCAGTATTGTCGACGCCGAAAATCCGATACATTATCCGAAGATGGTCGATAAGTAGGAGGCACAACACAGGAGCAGCATATCGAACG
CGGAATTTCAACATCGTTCGTGCGGTTGGGGTCAATGCGTCGAGCGTAAAAATCCACTGAGCCCATAGCCACCATGATAAAAAGGTAAGGCAGTGCGAGA
TAGTCCAGTTGTACAGGATACAAACCCCGATATTCGCACACGTGATTTGAAACGAGTAGAAGGCGAAGTCGAAGGACGTGAACAGGAGCTTAAGCAGTTG
GCGTTGGTACAACGCTGCAAAGAGACCTATAAACGCAGCGGTAAACAGCAGTCCAATGGAACATACCAGACACATTAGTTCTTCCTGTGCCGCAACACCT
TGTAACTCGTGAACAAGGGGGATCTGGGAGAGGATTAATCCTCCTAAACCAATGGTATAGACCACCGAGAGAAACCAAGTTGGAAAACACGTTTTCTTTA
CGATCTTGCAAGGCAGGAGGGTGTTGGTAGCGTCAAACTTTTGCGAGAATTTGACAAACATCAAGTGCTGGGTCACATCGGCACTTCGAAGTGAATTTTC
TTTCGATTGAGTCCTGGAATCCTCACTAGTCCACTCAAGCGAAAGTGACGGCCCAGAAACCGGCTCCAGTTTCAGTCGACATCGATAAATGACGCACTGT
ACAATCGCTGATGATCTTTTCCTCATATGAAGATCTTTCCGTCGTCGGAAAACGATTTTGACGAGTAGGAAGCCTAGTGACATCATTCCGTTCCCAATTA
CGTCGATACCGGAGAGTTTATAACTTCTGTCCATATTCTCGTACGTCACTATGGTGAACGTCGAGCCGCCATCGACTTGACGAAGCAAGATCCAAGTGAG
CACAACAGAAGCAGAGAGGATCGTAACAACCAGGAAATACGTTAAACTTCGGAGTCCTAAAACATGCGCGTCGACCAAAACAACGTGGTGATATCCAATC
CAATCGATGAGCATCCGCACCGACCGTAAATCACCAAAGTACATCGACGTCGTGACAGTGATAGTGGTCGTAATTGCAGAGAAAAACCAAAAGTCAAAAG
TTCGGGAAACCAAACGTACGATGTCGTATCTCAGTGTGGTAATACTGCCCAATCCGAGTGGAATCCAAAAGAGAGCGGCTAGCACCGCAACTATTCGACC
CAGCTGCACGTCTACCAGAGGAACGAAGACATTCAAGCAGTACGATATCGTAGCGCAAACCAGGACTTCTCGATAATGTTTGTAGTACTTGCGACGGATA
AACGTGTGGACTCTCCCGGGTAGAAGCCGACCTCGAAAAGACTTGGACAGATCCACTACAGGAAGAGGCTGCGCGGGCACCAGCGCGTAGAC