Description :
From Genome Similarity Track
Location :
scaffold_1515:148- 1470
Sequence
1322 bases(100 bases per row)
TGGGTGCTCTATGCAAATGTCCTGGTTTGTCTACTGCGGCCACTGCAGTACGGGTGGTCTACAACACAGCTTAACCTCGCCATGTTCAACAACGAAGAAG
AATGCAATGCTAGACCCATCGCACCCGGTACATACCTAATGTTTCCGAGCCGGAAGCGCACGATGATGTCCAATTGCCTCTTTATGATTGCTGGTTCAAT
TGTACAAGCCACCGCCTCCAATATATGGACGTTCATCGGTGGGCGAGCCATCTCCGGTATTGCATCGGGTGGGGCCACTGCTGTCATTCCCAGCTTCATC
AGCGAGATTTCACCACCAAACCTTCGTAACAGCCTCGATGTAGGCTTTCAGATCGCCATTACGGTCGGCAATCTGCTGGTCGCCATCTCATTTTCTTCAC
TGACACGAGCAGCGGTTGGCGTTATATTGCGGGATTTCCCACCGTGCTGGCGGTTCATTTCCTGATGCTCGCACCTTTCGTGATAGTGGAAAGCCCTGCG
TGGTTGTTGATGGTGGGAGAGCAGCAGCTCGCACTCCTGTTCGGTGAAGAGAACGTATATCTTGCTAAAATGTGGATCAAACGTGATCAGATGACTTCTC
TTGTCGCCTCGGGAAGTGAGTATGCCGTATCACCACCACCCACCACTTTGTCGACACCGCCCAAACCATGCAATCTACTCGAACTATTATCACCCATGCT
TATTCGGCAACTGTTGACAGGGCAGGGACCCAGCAGCTTACGGACATCAACGCCGTCTTCTTCTACTCGTCAAGTCTCTTTGAGCGCGCCGGCATTTCGG
ACGACCGCATCGGAATCGTGGCTGTCAACTTTGTCAACGTAATGCCTACTATGTTTGCGGGATATTGGCAACGCGCCTAGGCAACCGCAAGCTCATTTTA
TATGGGTTAGTAGGCATGTTTTTCAGTGCGGTCGGCATCACGGTTTCGCTCGTTGCTAGTGTGCCTGCGCTTGCCATCGTATTCACGGGGTGCTACGTCA
CAACATTCGGCTCGAGCCTCGGATCGCTGGCATCGCTGGCATCGCTGGCATGGGTGGTCATAGTAGATCTCTTCCTGGACGATGCCCGGGCGATAGGCAA
CTCTGTTTGTGTGGGATGTAGCTGGCTGTGCAATCTTGCGGTGGTCTGAGCTAACCTTACATCGCTGCTGCATTGGTTAACTTCAGCTTCACACCGTTCA
TGTACACTGTAGCATTGTCGTTTATCTTTGTGTACACGATCGTTCCGGAAACATCAGGCAAGACAATGCAGGAGATCCAGGACGAATTCGCCGCAAAAGT
GTTTATCCAAAATCCAAGGTCC