Description :
From Genome Similarity Track
Location :
Scaffold_9:147999- 150678
Sequence
2679 bases(100 bases per row)
TTCCTTATTGACATAATATTCTCGTTAAAAAGTATTTTACATTGATATCATGCATTACAAACCCCATTACAGGCGGTGCACACCTCGACGAGATTTTTGG
AAAGTGGTACCACGCCAACCTGCCAGTTTCAGTGATGAATGCTTACGACACGCCCTACAAAATTACTAAGATAGAGTCTCGTGCAAGGTGGAAATATCGC
TGGATCGTTCTCAGATAGACGCAAACTGCTCTACACCATCTAATGAATCTGCTATTCATCTGCCTTGACTTGCTTCCCAATGGATGAGGCAAGTGAATGT
ATCCAAGAGCACGCATACAAATGTCTTTTGAGATGCACAGTTATCGTTAAGTATTGGGTAATGATATATCAACCCTCTATTTTACTATTTCCATCCATTT
GAAACCAAAATAGGGTGTATTTTACAAATTTTATGGAAATCTTGTATGTCAATTATCGATTTAGGCTTCCGCACCGCCATTCACACTATAACAAAGTAAC
CACCAAAAGGATATGCTTAAAAATTGATGGAGGATGATATGTTCTTTTAGGAAAAGTTTCCTGTCAGCAAAGACGATGTTCAAGGCACTTTAATTCAAAA
AGATCGTGCTTAAAATTTATCACTTTCGATCTTCAGGTATGAATACAAAACGGGGTAAAGATCGTTGTGTACGATCGAGCGAAATCATTTAAGTCTGTTG
CTGTCGAGCAAAGGACCAAAAAACGCACAGGATGCAAGTATAAACTCATACCGTGACTATCGGCGTAGCAAGCTGGGGGAAGTTATCCAACAGGAAGAGT
GCACAACCATGACATGTTCTAACCCTCGACATGCATACTAGTGCTAGACGTCTAACTATTAAGCAAAAAATCCAGCGCGTTCGTCTTGATAGAGCATGTG
TGCGGATATGTTAGCAAATTGAGTTCCTCCGACAGGAGTATCTGGACTCCTGTAGCGTAAGTCGAAACAAATACATTGACAAGCAAAAGGGCCGGAGAGA
GTACTTAAATGTGCGCATGCCTATTCAGGCACTGTTCTAGACGAGTTACAAGTGAAAACGACCTATAAATCTAGCTTGACGCAAAGGGTCAAACCTGCAA
CTCAATGTTTGCGAATTCTCAATCCATCGCTCTTGATGTAGCGTTCTGTGGCGTTATTCATGTCGACTGCACGTACAAGACAAACAGGTTCAAGATCCAT
ACGATCAATTGTGTCGGCGTCACCCAGTTCGGCAAGCCATTACTCATTTGCAAGCCATTTATGAAGAGTTAGGACGATCAAAACAACATAGAGGTCTTAA
CGCTTTAGGGATGGTGCTTGAGAGTCGAATAAATGACTAAGGCCCGCCGGTTCTATAGGCGACAACGATTCGGGTCTTACACGCTGAGCAGTAAGATATG
TCGAACGCGAGTTGTTGCCAAGTGCAAAGCTCACTTAACTCATGGCGATGAAATGGGAAGAAATGGTTGTGAACCAAATCACTCTTTGCTATGCATCAAG
TGTCGAGATTTTCGAAACACGATGGGACAGGTTCTGACCAAGTGTTGTCATTGCCCTGTCTTCATTCGATATCTGTGACGGGGTGCCTCCGTTACATGAT
AATTTACTTAAGGTAAATATCAAGTACGAATATTGCGTTAGGACAAACACAATATTCTCACAATACTATCCTAATAGATAATATTGCCCCGCAGATGTAA
CACACTGTTCATTGGTTGATATAGGATCAAGATATCAACCAATAAAGTCTAGCCACGACAGAAGCACGCAACGAATGGCGCGCAGATAGTTATAATACAT
GTTTGTATTTAGACATAGTTAAGTGAAGTCAAATAGGGATTTATTACAAGGATTAACTATACTAAATACAGTTCTACCTTTTATCTTTACTGAGTACTTA
CTCCGTATCGCAATCTTCCTCTAAACGTACGTGTACGTGAGGTAGTCGGACGTACACACCCTTGCACTGTCAGCAGTGCAAGGTTTATTCAGTTACTTGA
ATAAGGTGTACCCCGTTACACCTGGTAGCACTTCGTAGTCCGTTCAACGACCATGAACATGATGGACTATGAGGGAGATGATTTTCATCCCACGCATGAA
AGCAACTCCCATTTTGAGTCAAACCGAATGGGATACTGTCAAACACTTGAGTTCAACGATAGGGCAAGAAGCCGTTGGCGCATTACTGTCCGCCCTGGGG
CCAGACGGACAGCACGCCACCATCGCCAAGTTTATTCAAAATGAACTTGACGCCGAGCGGGAAAAAGTAACCTTACTTCATTAACAAGGTTCTCAACAGA
CAGATCTGGTGAGAGAACATAGTGCTCAACAGTTTGAACTGTTGAGACAGCAGCAGGCCACCGCTACCGGGTCGACGTATACACGTCGACCCGAGACTCT
AAAGATTGACATCTCAAAGTACAAGGGAGCCGATGAAGACTCTCTGTTGAGATGGTTCGTGGAACTAGACGATGACATAAGGGCTCGTCATATCGTCGAT
GAGGAAATGAAGATCGCATTTGCTCAATCGAACATGGCAGGACGTGCAAAGACGTGGGCCTTGGGCCTTAAGTTACACGACCCATATGTCTTTGGGTTGT
TGGAAGTCTTCAAGTCCCTGCTAAGGCAAACTTTTGAGCCTCCGCGAGCTGAGTTCAGGTCTCGCTCTGAACTCCTGAG