Description :
From Genome Similarity Track
Location :
Scaffold_355:14794- 16801
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_355-snap-gene-0.13Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_355-snap-gene-0.14Gene of unknown function

Sequence
2007 bases(100 bases per row)
CACCTGCAATACAAGCAGAATCGCGGCATCACACCGACGGATAGAAGACATTCGCGGCGTGTTACAGGAGCAGGAGCTGTTGGAAAACGATCCTTTCGAG
TCAGGGTCGATGGAGAAAATCAGCGATGTGGGTGATGCAATCGCGCGGGACGCGAATCGTTGCTACAATGACGCAACTTCGCGGAAGATGTACCTCGCTG
CCTTACGCCTCAAAAAGCACCAAGCATCCGCGACAACAGTATCACCGTCGACTGCGATCCCACCACCTCCGCTGTAGGTCATTCAGACTTAGTTGACATA
TGAAGCCTGATGTAAGAGCTTTGTCGTTGTGCGCCACCGTGCGAACGACTACAGACGGGGGTTGAAGATGATACGCTGGTGGGAATTCGAAGGAAGGCAA
ACAGCAGATACATCAGACGAAAATCGCAAGCAGAAGGATCATTATGATCTCCTCATTGCGCACGATAATCCGCACGTCGTGGCCGCATGAAACCAGCGAG
TGCCCAAAGTTGCCAATCGAATCAGATCGACCATTATTATCCATTTATACAGTTCATAAAAATCCGAAACATCATCTATTGTCTCCATATCAAATCATGC
AGGTGCCGCTATTCGACTCCCATCCTCATGGACACTTGCACAATTGGGGCAAACAAGTCAAGCGACAAGACCACAGGAGACGATGGCAGACGATGCGCAG
TGGCGACACCTGATCGTGCAGCCACAGGACGTCGTGGCGATGCTCACGAACCCGCTCTCAGCGCCTCGTGCTAGCAGCAGTAGCAGTGGCAGCGGCGGCT
ACGCGTCGGTGTCATCCTCAATGGCACCACAGCGCGTGCACAAGCCTGCTTCCAATGGTACCAAGTCCTCACGGTCGCCGCAGAGCAACTACGCCAACAA
GAACCCGATGCTCATCAAGCGCGTGTACCAGGTCGCCGAGTACCGCAGAGACTTCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGG
TCCCGCGCCCATCCCGTGCAGCTGTACTATGACGAAAAGTTCCGCGAGTACGAAAAGAAGTTCGTCGCGTGGCTTCGCAAGAAGGTGACGCTACAGAATC
TACGGGGCAATGCACAGCGCGAACGCGGGTACCGCATCAGCTTTGCGAACCTGTGCGTGCTCGGAGACGATCCAAAGAAGCCATCGCGTGTTCAGCAAAC
GAGCAAAGTTGTTGTTACTCAGGACGCACCACCGCGACCAAGGAAGCGCGGCATCGTCCGTCTCGGTGACAATGACGGTGATGACGATGACAACAATAAC
AGCGAATACATTGGCGATGACGGACCGCTGTGGAAGATTCACATCAAGAATGAAATGCCGTCTCTGACGCTTGTTGCGGAGCCCAAGTACATTCCACCTC
CAGCAAACGCGCTGCTGCTTCCACGGTCTGGTCTCAAGATGTCAGCACAATCAGCAGCACCAATCAGATCTTTACGCAACAGTGTAGGGCTACGTTGCCT
GATCCCAAAGCATCGCATACTACATTTTCAGCAGCGTACATGAAATGCTGTTGTCAGCAGTGCCTGCGTGACTGGGACATCATGCTGACAGAGCGGCTGG
ATGCGCTGGAGAAAGAGGTGCACATATTGCGGAAAACGCAGCAGACAGCTCCTCCATGCAGCGGCCATGGTTGTGACGTCAGCCATAAAGACAAATGGAA
TGCAGCAAGAAGGGGCAGCATCAGACAAGGCGTACGTGACAATTTGTTGAAGCCAATGCCATGGTACGGATCAGAGCGAGACGAACGATGTCGACGTCGA
TAATCCGGAGACTTCTTCCAACGATCCAGTGGTTGAACCAGAACCTCGACAGATGGTAAATCCACGCCCAGCTCCACGGCTTCTGGTATGATGCAGAAAA
TGCAGTAGTGCTTTGGGTGTTCATAGCCCCCCCTCCTCCCCCCCTTATGGGACCTGACATAATGCAAGTCGCTTAGTCCACTCAGCCAACTGTACTCAAA
TGAAGAG