Description :
From Genome Similarity Track
Location :
Scaffold_870:14793- 18485
Sequence
3692 bases(100 bases per row)
ACAGCTGAGTGACTGATCTAAAGTGCACGTCGGGCCTCATCTGCAGGGACTTTTGAGACCAGGCAGAGCTATAGTGTCGCCTAATCAATGCGCTGATGTG
GCGCGTGAGTTGATAGGATAGTGATTGTGACTGAGACAGTATGCTACAATATTCTTGCCACATACAGTGCTGTTGGAGCAGTCTAAAAGCTGCGGCGCGC
GGGCGCACTGCAAACGAATCGCCCGATGTGTATGTTAAGGTAACAGGTTTTGACCGGTTAAGAAACCTGCAATGCGTATCCGTGCATATTTCAACTATAC
ACGCATAGTTTCACGTAAGCTGGCACAAACGAAAGCGTGCTATACACTGAAACATGACGGCTGCATTTCATGTGTTAAACGTGCACAGCACGCTGGTACG
CGTGGAGCTTCTCCGATGCATACGAGGAACGACCTTGACACCAGCGCATATGTACACGACTACATGGCTTGACACTGTATTTGCGCATCACGAACGCGTA
CGCGACACCATGAGGCGTATCTGCGGCGTGTTGCGTACACGGAGCGTCAAGCGGAATATGCGCGCTATAACGGAGATTGACGCGGTGCCTCCTGTCACAA
AACACAGGTGTGTGTCGCGGTACAACCTGTGGTGTGTACCCCGCACGCAATATCCATGCAGCGTCATTGGTTCATATACGTGGCTCGCGGGGTTTTTCGt
tgtacaagctgctccagtgttATATGTAAATGTTACTGGGTTACCGTCGATAGATATTCGCCGTTAGTAATATACAACACGGAGGCATCAGTAAGCGAAG
GTCTACGGCATGCTTGGCCCTCGGACCCTGCTCTCTCGAAAGCGAGCGCTATATGTACGCATGTTCAGTACTAAACACAGGTCAACGGTGGGCTTAGCAA
CAACTCAAGCGACTCGAGTGAATTATAACGCTAAAGTTTGCTCTAACTTAGACAAGCGCCGTGTGCTCTACTACTAAAATAATTTCAGTTGGCGCATGCG
TGGCGACACTGGCCAACACGCTACTATACTGGGCCTGCCGCGTAACCAGGATCGCGCATACGAAGACCATATACAGTGCTACGAATCGTATCGTATCCTA
GCTTGAGCTGTGCAGCGATCGCTACCACTGATAGTACTTCATGGGTAGTGAAACTCTGTTTGCACACGGACATTTATACGTGTCGCTGTCCAGAGTGACT
TCGAGAAAGGTGATCAAGATTGCAGTAGACTCGGTTGCTATCGATGAAGAGGGAAGAGTACACACTAAAACCATCGTCTACAGAGACATTTTCGAACCGG
AGAGTTCGTAGCTAACCAAGATATACTTTTGAATATTCGAATATTCCATGTCTAACAACTCAGCGAGTGAATCACTTAAGTAAACTATTTAGTAAGTGAG
TGAGTAAATAAATAGTATACAATACAAAAGAAAATAAGCGCAGCGGAGGTGGTCCAGCCTACGCTACTGTGGACAACCAGGTGCAAGCGTCCGGGTAGCG
GGTACCCAAAGCGAAAGTCCAAGTCATGAACACAATAATACTTATCCTGACTCATGATTCCTGGGATAGGATGTAACGAAGTCCAATTCCACAGGGTAGG
TACATCGCTATACCAGTAAAGAACCGAGTCGCGTGGCAACCTAGGGACGGTGGGTCAGCGGAAATACATATTGCGCGTTCTAGTCGAAGTTTTCCGAACG
GGATTTATCCAATCGATCCGGCGAAACCGCTGCAACAAATCGTTAAAAGCACTTCAAGTTGACTATGAATACGTTAACCCTTTCGTTATTGTCATACAGT
TCTATGTTAAGCCTTCCATACAAACTTCAAATCTAAACTCTAAAACCGTACTTTATGTAGTTCTATAATAATATTTCTACCAGGTGTTTCACTTATTATG
CGATTTTTTATTTCAATCTCAAAGGTATTTGTGTTGAACCATACTTAAAGTCTGGTTTTTGCAATGCGACCTGCAATTCGTCAAAAGTGGATGTCTGCCC
TTTTTCTGTCACAAATTGGTTAGTAGGAGCAGTACCGTGAGGAACAGTGTTTTTCATGTTTCAGTTTCCTGTTGGAAATGATGCGTCACAGAGCATAAAG
ACCGATGACATGAGCACCTGAGTCGCAAGGAACCTCTGCACCGGCTCATTAGGAGCACTCCTACGTCCGAAGAAGGCGTGTTAAATCACAGTACAACAAG
AAATCTGTACACGTGCGTGGTCGTcggcaacagcagcggtaAGAAGTTGCCGCCGAGCGTGATCGCTGGCAGCAACATAATAGACCCCCTTCTCAGGCCG
TGTGGGTGTAGTGGGTTGTCTTCACTGAATACCGCTTGGCTTGTTCATAAATTATGCTAATGTTATTGCTTGTGTATGCTTAAATGTGCTCTTCCTTTAG
CTTAGGTGTTGTGAAGTCTGTGACGTACTCAGTGGATACTGAAGAATGTATTGTCTTAGATTTTACAATTTGAAGCGAAAGCCAAGTGATTAATTCAACG
AATCGCCCATAACAATTTCACGTAGACCTCACAATACCCCGTTTGATACACGTATAACAAGGCTAAAACACTCGGTGATTACAGGCGTCCAAGTATACTC
GCGAGGCGGGAAAATGGAGCGCAAATGGTTCACAAGACATGCCAAGTGGCCGTGTCTTCAGTCATTCCGAGGAGCAATAGAAGTCACACTTGCCGCAAGA
GCACCGCTTCCAAGTCGATGGATGCTGTATCTGATCTGCAAGCATGTCGACAACGTCCATTGCTAGCAGCAAGGTCACATCTCAATAGCAGATATCCACC
ATGAGGACGCCCATCTTGCACGTGATTCTCGAGAGTTTCTAAATCTATACTGTCATCTTCACACATTTGATGATAGCGCTCGATATTCTTCTCCAGAAAC
TCGCGTTTTTGCATAAGTTCAGTGCTGAATGCTTTCAATCGCGCCCGGATAAGTGGTCTGTGATCTATATTGGAACGATCACAACCGGTAAGAAAGAATG
AGTCGGTATTGTAGTGTACAGCTTACTTCCTCATCTCAGAGAGCTCCTTACACAAGGTGGCCCAGCGCACCATCCAAAGGTAGATGTGCACGCTTTCTTC
TTTGCCAGCACAGAtgtcgacatgaagatcGTGCATTTCCTTTACGGGTAAAGCTGCCATAAACACGTCAACATTCCCCGAAGACCGATACTCTAGCTCA
AATTGCTGTGTTGATATGAACACACAAGATCGCTTGTATGTTTAACCACAAAATAAGCACGAATTTGAACGTACCCAACCCCTAGAAGGTATGAACCTGG
GATACAAGGTGTCGAAGTTCACGATCTTCCCGCAGCTCAAGACACTTAGTGACTGCGATACACCTCGTAAATTATTATACCTCTTATTACCTCATTAGAA
TTGCGCTTAGATGTAGCGTTATCACCTCTTCCTGGCTTCTATCTTTCTATATACGTCTTCCGTTGGGTGCTAGCCTCACTGAAGGAGCTGATAACATGAA
CGCGCCCTTGTCGCGCCTGTGAACAACCATTTTGCGCCAATTCTGCTAGCTTCCGAGTGTTGTGTCAAATGCCATCGTCCCCGTGGCCACTCATGCTCAA
GGCGCCACCGGTTCGATACATGTGAACCGGCCCATGGAGACCAAACGTATTATCGTTTGTATGGCTTTTGGAGGTCAAATGAATTATCGTTT