Description :
From Genome Similarity Track
Location :
Scaffold_46:147918- 152645
Sequence
4727 bases(100 bases per row)
AAATTCAATCACATCTCTTTTTTCTTCCTTCTACTCAAGCTCCTCCACCTTCCTCGCCTCACCTTCAATAGGTTATGAGCCCAACGCAAGCCTCCACCGC
TGACGACCGCGAGTTTCCGCGCCTCAATGGCCGGAACTTCATCATCTGGAAGACCCGCGTCACTGCCGCCCTCGAAGGAAAGAACCTTCTTGGCTACGTC
GAGCGTATCGACTACACCGATGACTCCGACTACGAGTTCGACTCCGATGAAGAACTCAACCCGGCACTGTCCGACATGAACGACATGTCCGCCGCGCTTG
ATGCTGCCGGTGCTCCCAAGGCCGACGAAATGGTGGGCTCCTCACCGAGCGAGTCCTCCTCTGATGCCAGCTCCGCAAGTTCGGATGCACCCACAGCCGG
AGACGACGGCGATGTGGAAATGGGGCAGGAGAATCCCCCCGTTATCCAGTCATTCACTGCTCAGAAGCGGGATGAACTGAAGCGAGCAGAGAAGCTGAAG
GCTAAAAGCCAGAGGCTGAGCTCGAAAAAGCTTCGACTCAACGAGGCAAAAGCAAAAGCTTTCCTTATCAAAACCATCGATGACCAACATGTTCTCATGG
TCAAGGACAAGACTACTGCGTTTGAGATCTTCCAGACGATCTGTAGCAAGTACGAAGGTGCTGCCATCCACGGCGACCCGTATCATGTGCTATCATACCT
GATGGCACTGAGGTATGAAGAAGGTTCAGACCTTACTGGGTTCATAATTGACATCGAATCTGCCATGAAGGTTGCCTCCGAAGCCACAAACAGTGTGCTC
AGTGACGAACAGAACTTGTACCATGCGCTACCTGGAAAATGGAAGCAGCAACTATCGGTCTGGAAGGGTAGCAGGAAATTAATTTCCTACGAAGAGCTAA
AGCGTCACATCGAGGCCAAGGTGCAGCATGAACTGGCGAAAAACCGCTACACGCTCAAACAAGGAACACCCGAATCGAGGGAAACCCGAAACGAGCAGGC
CCTACAGGTTTTAGCACCTGAACCAACCTTGGTTCAAGCTCCCTATCAAGAGAGCAAGGCTCTCATCTCAACGATGAGCTGTACATACTGCCTGCGCGCC
AACCACGATACTGTCGACTGCTATGTTCTACAGCGCCACCTACCAAATGGTCAGGTAAAGGCAGGAGCGGTGCTTCCCGCCAACTTTAAGCTGAAACCTT
CGTCCAATCAAGCTCGACAGCATCCTTACAAGGACGGTTTCGGCGGCAAGTCACGAACCCAAAATCGGAATGACTACAAGAGCAAGCGGAACAGCAATCG
AAACAGAAGCCAGAACGGCAACCAGAAGAATACATCTGAAAAATCCAAGAGTCACAATAAATTCCACGGTCGCCACAAGGACACCGACTCCGACAACGAG
TATGGAATCATAGCCATCACCACTCTGGACCTCAGACAAGAAACAGAGGCTGTAAGTCTCACCGCCCAAGATGCGGAGCATGACCCAGTGTGGACTGTCG
ACTCAGGCTGCACTCGCCACGTTACGTCCAATCCGAAGTGGTTTGAGAAGCTGATCCCAAGTGCTGGCAAGTCAATCACTGTCGGCGGCAATCACCAGAT
TCCGATAAAAGGAACTGGTGATGTCAAGATGACAATCAAGGACACGAAGGGAAAGGAACGAGAAATATCCTTGGCCAACGTGCTATATGCGCCCCAGCTG
AAGTTCAACCTACTCTCCGTGCGCCAAGCCGTCGAAGATGATTTCAAAATCAACTTCCCCAACGCAAAGAAGTGCGTTCTGTTCTTCGCTAGCCGAACCA
AATTTGAAGCCAAAATTGGTGAAGGGACTCGACTCTACCAGTTTCAAGCGAGCCCGGCAACCTCAAGTCAGGTAGCCCATGTGGCCACTTCAGGTAAGCC
TGATAATGTTATACTTTGGCATAAACGAATGGGTCATCCTAACTTTCGCATTATGCAGGATCTGGCTAAAGCCAACACTGTCATGGACATGGGCCTGAAG
GACTTTGATTCCAAGAAAGACTACTTTTGCTCTTCCTGCACATACGCCAAGGCCCATCGTAACCCATTCAATAAACGTACCGTTGAACGGGCAAAGTTCC
CTCTTGAAAAAGTTCATTCTGATATGGCTGGTCCATTACCCGTCCCCACACTCTCGGGGTGTCAATATTTTCTGACCTTTATAGATGACAACTCACGGTA
CATGTTCATCTACATCATCAAGCGAAAGTCTGAGCTGTACGAATGCTATGAAGATTTGCGCAAGAAAGCACAAAACGTTTTTCACGCTGATGTAGGCGAA
CTCCAGTTCAATGAGAACATACACGATGAAGAAGTTAGACATCTTCAAAGCGACAATGCCCGAGAATATGAGAAACTTGGAAAAATGATTTTTCAGAAGT
ACAATACGCACGCACAATTTACAAATGCGTACACGCCCCAGCAAAATGGAGTTGCAGAGAGGCGCATGCGTACACTACTCGAACGAACCAGAGCTTTCCT
CATTGATGGTAACCTACCGCAGGTTCTTTGGGGAGAATGCGTCAAACACGTTGCTGACCTTCTGAACATTACTCCCAGCTCGGTAACCGAAAAGGTCACC
CCATACGAGAAATGGCTCAAGCGAAAACCATCCGCGCACTACATCAAAGTGTTTGGGTGTACTGCGTACGCTCACATCCCTGAGATACACCGCACAAAAC
TAGAACCGCGTGCTAAGAAGTGCATGTACTTAGGACTCCCATCAAACAAAATGGGATATAGACTCCTTGACACGAAAGAAAACCGTGTTATCTACAGCAG
GGATGTTGTGTTTAGAGAAGACGAGTTCCCACACTTGGAGTTCCTCAATACACCCGCAATCTCGGACCAAAATGGCCCCGCACCAACGCTATCACCGTCG
CTACCAACACCACAATTGCTACCTCCAATAGCCTCACTACTAAAACGCAGCGTCAATGCGCTTGCCGCGGAAGTAGTAGTAAAGACGAAGAAAGTCAAAC
ACAAAACGAACGCTCAGAACGAGGATGAACACTCGTGTCTACTTGATGATCCACTCGACATTAACGAGCGAAAAGAGCACCTCACTCATATCTACGCTCT
ATTGGCTATCAGACACATATATGAACCAAAGACGTTCCTAGAATCCCAGAAACTACCAGAAGCACAACACTGGGAGAAGGCAGCCATTACAAATCATTGA
TCGACAACAAAACGTGGGTCCTCACAAAACTACCGACAGGGAGAAGGGCCCTACAGTGTCGATGGGTATTCGTTGTAAAATACAATGGAGACGGCAGTAT
TGACCGCTATAAAGCTCGCCTGGTAATAAAAGGTTTTTTGCAAAAGTATGGCGTTGACTACGATGAGATATTCTCTCCAGTGATCCGCATGGAAGTGCTG
CGACTTTTACTGACGATTGCAGCACTCCTTGACCTTGAGATCCATCAAATGGATGTTAAAACCGCTTTCCTGAACGGATACCTCGATGAGGAAATTTACA
TGCTGCAACCTGAAGGGTTTACTGTTCGTGGGAAAGAGCACTTAGTCTGCAAGCTTTTGAAGAGCCTATATGGTCTCAAGCAGGCACCTCGGATCTAGTA
TCTTACCCTGTGCTCTTTTCTTCTCACCATGAAATTCCACAAACTCATCAAAGACCAATGCGTTTTCATTGGAGTTGTGGATGGAGCTACATGCTACATT
CTAGTCTATGTGGACGACCTCCTCATCATAGCCCCTACGCTTGATATCATTAACAACATAAAGAACGCTCTCAAGCAGCGCTTCAAAATGGCTGATCTCG
GTGAAGCTCAATACATCTTAGGCTGGTCAATCGTACGCAACCGTACGGACCGAACCATTTTCATCCACCAAGAGAAGTACGCTACCAAAGTCCTGGATCG
CTTCTCTCATCTTGATGCACACCCGGTGGTACACCCGCTGATCCCAGTGTGAAGCTGACGGAGGCCATGTGCCCCCAAACGCCAGAAGAAAAACATGAGA
TGAAAGCGATCCCGTACAGAGAGGCAGTTGGTAGCTTCATGTACTTAATGATGGGAACTAGACCTGATCTCGCATATTTTCTACGAGAAGTCAGTCAATT
CCTGGTGAACCCAGGAAAACCTCACTGGAATGCCGTTAAGAGAGGATTGAAGTACTTAAACGGTACGCGCAATCTTGGCATCACCCTTGGTGGAAAGCAA
AATCTAGAGCAGTATAAGTCAAAGCATTATCTCACTGCATACTCCGACGCAGACTATGCCAATTGCCCAGACACACGACGATCTGTGGGAGGCTATATCG
CATATATGTGTGGAAGCCCAATTTCATGGCAATCGAGAAAGCACCACACCGTAGTTCTGTCCACAACAGAGGCGGAATACATAGCCCTATGTCACTGCAT
GCAAGAAGTTATTTTCTTAAAGCTTCTTTTAGTAGAGCTTAAACACGAAAGCTCACATGCTATTACCCTATTTGAGGACAATCAAAGTTGTATTAAACTT
TCCTACAACCCAGAACTGCATGGCAGAAGCAAGCACATTGACATTCGGTATCACTTTGTACAAGAAAAAGTAGAGCGAAAAGAATTTGAAATTATGTACT
GCAACACCAAAGAAATGGTAGCAGACATTTTTACAAAAGCACTATCAAAACCTCTTTTTATAAATCTAAGAGGGTCACTATGTAAGACACTCATACAAAA
ATAAGAAAAAGAAAAAAAAAAGGAAAA