Description :
From Genome Similarity Track
Location :
Scaffold_1198:1479- 7282
Sequence
5803 bases(100 bases per row)
AGAAAATCTGGGAAAGCCGACATCTGCTGATTGGTAAAGGTAATGCATTACCGCCCGCCGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAA
GCCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGGCCTACTGCAAGCCAAGATCATCAGTTTCTCA
ACGTCCCCGTGGGCATCTCCGGTGGTAATCATCATAAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTAGTTAACGGCCTGACTCGAT
TGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGTTCTCTAGACATGGCCAGTGGTTTCTGGGTGGT
TACTATGACGGATCGAGCTTGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGACGAACGCACCCCAG
ATCTACCAACGCCTGATCGATAACGCCCTCTATGGATTCACCCAAATACCGGAACCCGAAAAGGGTGGATCCGGGGAAGATCATACGGAAGTGGATCCAT
TCGAAGCAGGAGAGCCAGGGGATCATCGGACCCCGTCTGTGTTAGGACGCAGATTTTATATCGACGACATTCTAATCCCGGCGGAATCGTGGGATCAGTT
GTGCGAAAGCGTGACATCCCTACTGGAGGCGTGTACTAAGTGGGATCTCTCTATCAGTGTGGTGAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTA
GGCCATCGAGTCTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCGCTAGCTGACTTGTCCTTCCCACAGTCGTTACGGTCGATGCAATCCT
TCTTGGGCAGTTTGAATTACTACAGTCGGTTCATCGAGGATTACGCACTGTTTGCTGCGGTACTATATGAATTGAGAGAGGTAGATTTTGCTGCGATGAC
CACTCCAGCTGTCCGGATCAAAATCCAACAAGCTCTGGCCCTGGAGATGCCGGATTCACGAAGGGATTCAAGTAGTACGACGCCAGAAGAGGACCTAAAA
CAGGAGCTGGATCCACCCCGGGACCAACGGAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAG
CTCAGCACGCATTCGTGAAACTGAGGAACAGGATCGCGATCACGCCTATCCTCCGTCATTTCGATCCAGAACGTCAACCTACGGTAATAATTTATGCCAG
CGACTGGGCAGTCTCAGCAGCTCTAAATCAAAAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGACGGACACTGAAGCCGAATGAACTGAACTAC
GGAGCGGTGGAGAAAGAGATACTCGCGCTCATGCGCGTGTTGGATCTGAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACCCGACACTCTA
CGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTCTACTCTCGCCTTGGACACTGGAGATTGTGAAATGTTCGAA
AGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAGGGTCGCTCCTAAGAAAGAGCCCAAA
CGCCGGATCCAGATCCCGATCCCGACGGTACGAGTGGATGAGGATCTGTACGTCTTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGAGGAGCAT
ACAGTGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTACGCGGAAGGCGGCACCGTCAATGAAGCGGGGTATAGCGGGCT
CCTTCTGGGTTTGGATTTACTAAAGGGACAAGATCCAAAACGGCTGGTGATTTGTGGGGATTCGAATTTGGTAATCAGACAGATGCGAGGTGAGATTGAC
TGCAAGGCCCCGGCCCTAACACTGCTACGGCAGAAAGTGATGATCCACCTGCGCGGTTGGATGAATCACGAGTTGGTGCATGTCAAGTGAGATTGGAATG
CCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACT
AGACGAAGTGGTGGTAGTGGGGTCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGGTTGGATCCAGCCCCCAGATCCTCGGA
GAAACATTTGTGAAGGGAGTCCGCATTAAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCTTGGGACTAAAGAAGTATCTGATGGGGGATGTAC
GAGACCTGAGTCGGGAGGATACCAAATCCTACAGTATTATCGCTACGGATTACGCAGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAG
AGTCGACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGGTAATCTTACAGCAGGATGTCCTACACCACTATCACGCTAGTTTAGAAGGTGGACAT
CAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTCCATTGGAGGGGACTATTCAAGAGCGTGCAACAATATGTCGGTGAATGTGTGGATTGTG
AGACAGGCAAGGGCAGGCCCACGATCGAAGGGGAGTCACCTAAAAATGTTCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTGAGTCCGAGTCCCCCCGATGGCTACCTATCATTCTAGTCCTCATGTGCTCCACGCACACTTTAATGCCACCATCACGTCGGGCGACTCGAGG
CTGATCATCGTCAGTCTTCACGTCGCCGGCGCCCGGCGACCACTTCGCGCACTCCTGGACTCAGGAGCGTCGAATAACTTCTTTCGCGAATCGTGCTTAT
CGATGCTTCCAAGAGAGATCGCAGTCCGTAATGGTCGAGGTCAGGTCGTCGTCAAACTTGCTGACGGAAAGCCACGCCGAGTTGCGCGGCGCGAGATCAC
GTTGCCATACACATTCGACGGCTTCTGCAGCAACGACGACTTCCTCGTGATTGAGATGAACTACGCGTTCGACTGCATCTTGGGTATCCCGTGGTTGTCA
CGATATCAACCAGAGATTGACTGGTTGGCTCGGTCGGTTAAACACCGCTCTGGCTTCGATGTGAGTGAGGTGTTCACACACCTCCTGGTTGCTCAGAAGG
ACTGGCCCCACGTCAGGGTTGTGGACCGGTTGTCCACAATGCAGGTTGAGCAGAGAGCGAGCGATGGCCCTCTCTGTATGTCTTGCACAGCGCTGTTGCG
CGAAAAACCCTCGCTGCGAAGCGAGGTTGTTAACACTTTGGCGGTAGAGCAGGGGCTCCCGCAATCCAAGCAGGCGGTCGAGCATGGGTTCCCGCCACGT
AACACGGCGGTCGAGCATGGGTTCCCGTCACGCAACACGACGGTCGAGCATGGGTTCCCGTCACGCAACACGACGGTCGAGCATGGGTTCCCGTCACGCA
ACACGGCGGTCGAGCATGAGTTCCCGCAATACACTCTAGCGGTTGAGCAGAGGTTCCCGCAACGCGATTCGGCGGTCGAGCAGTTGGAGCTCCCGTCATC
CACAGCGGTGGTCGAGCAGTTGACACCCCCACCGGCTACGACGGCGATCGAGCAGGGGCTCCCTCCAGTCGATGGCGCGGTCGAGCATCGAGAGCTCCCG
CGCACTACCGACACGGTTGATGGTGTCCTCCCGTGTCTAGAGGGGGGTGATCCCTCGTCCAGCGATAGCGAGTCTTCTGTCTCGAGCAGCGGCTCGAGAC
GCCACAAGAAGAAATCCAAGCGACGCCGTCTTAAGCGACGTGGTCAGCCCTCCGCCGATATCGCAGTGAATGAGTCCATACACGTCCTGGAACACGTGGA
AGGAGGCGCCGTTCGCTCACGCACACTTGACATTGAGAGCCCACCTCGCGAAGCTTCTTCCATCACACGCCTTCCGGGTCTTTCCTGGAAGCATTTTCTG
GGCGATCTGAAGTCAGGAGACATCGAGCAGGTCTGCTTGATCACCGAGTCTGCCTCGGCGGAAAAGATCCACACGGTCGCTACCGACAATCTGTCACTTC
GTG