Description :
From Genome Similarity Track
Location :
Scaffold_114:147888- 150570
Sequence
2682 bases(100 bases per row)
TTACCTCCCGATAGAGGTGTACGTCATGAAGTTGAACTAGTTCCAGGAACGAAATACTGTGTAACACGGTAGTGGCCTTTACCTAAGGAACAGTGCGAAG
TCATTGACGATTTCTTTCGTGCTAAGAACGCGGCGGGAATGGTGCGGGAGAGTAAGTCTCCCCATTCCACACCTACTTTTTGTGTCAAAAAGCCTAATGG
TAAGTGGCGTATTATGCACGCTTATATTAAGCTTAATGCTACCACTATCCCGGCTCAGACACCAATCCCCAGCAAGGATGTTCTTCAGAACAATATGGTG
GGATGTACATTGTACAGTGCTCTCGACTTAGTCGATGGTTATTACCAGCTGCTCATGCGAGCAAGCGATATCCCGCTAACAGCGGTTAGTACCCCGAGCG
GTATGCTCTGGGAGTGGCTCGTTATGTCACAAGGGCTGTCAAATGCCCCGGCTACTTTTAATCGTCTGGTGACGCAACTATTCAGACCTCATCGAGGCTA
TGCACAAACGTACTTTGATGACATCTTTGTCCATAGTCGTGCAACGAACGGTCGATCTGATGTGGATAATCAAATTGACCATTTACGAGCGGTGCTCGAG
TGCATGCGCACGAATAAATTGTATGCAAATGCATCTAAGTGCATCTTTGGTGCAGAAGATTCCCTTTCTAGGGTGCTTCATTGGGAACTGAGGCCTTCGA
GTGGACCCCGCTAAGATAAGGGCATAGTCGATTGGCCGGTTCCAAAGAACCAAAAATATCTACGTAAGTGGCTTGGCCTTGCCAATTACTTGCATAAGTA
TAGTGAGAATTACGCAGATATGGCTCGGCCATTATCCAATCTCCTTAAGAGGGATGTGGATTGGTGTTGGGGTAACACCGAACATGAGGCTTTTCAAGCA
GTTAAGGAAAGCCTCCTTCATGCGCCAATACTGGCTTTGCCCGATCCTGATCGGCCTTTCAGCGTCGTCTGTGATGCATCTGACTTTGCCATAGGAAGTG
CTCTTTTACAAACAGATGTGGATAGACGCGAACGCGTCATTGAATTCGAATATCGACAGCTCAAAACTGCTGAAAAGAACTATTCAGTTCATGACAAAGA
GCTACTTGCTATGAAGTACGCTCTAGTCAAATTCGGAGTACATCTTCTTGGCTCAAAGCCATTTGTGATCTATACAGATCATGCATCATTGCGCACTGCG
AAACAGTCGCCGCATCTCTCTCAGAAAATGGATCGTTGGCTTTACTTCTTTGCCGAATATAACTTCGAAGTGAAGTATAAGCCAGGAAAGCAAAATGCTT
TGGCTGACGCGCTATCGCGCCGATCTGACTATGAGCTTGCTCACATCACCACACTGTCATCGTCAGTCACTGACTTAATCCGTGCGGCTTATGCCAAGGA
TGAACAATGTGTAGCTTTGCTACGTGCTCTTGGGAGCGAGGAGTCTAAGGACTCGGACATAGAATTGTCGGCACGTTTACGTGCGAGGCTACCTCGATAT
TCTATCGATAATGGCCTATTGTGCTATTGCACAGATATTGAGGATAACCCTCGTATCGATGTCCTTAATGATGAGGAGTTGAAGTATCGAATACTCTATG
AGGCACATGATACCGCTTTAAGTAGTCATCTCGGTCGTGAGAAGACCTATAGCTCAGTGAGCCAGGCTTATTGGTGGCCCAAACTATACAAGTCGGTGAG
CACCTATGTGAGTACGTGTGAAACGTGTCAACGAGTAAAACCCTCAGCACATGCGGCGGCACCGCTGGATAGTCTGCCTGTACCCACCGGGTGTTGGGAG
TCCATGAGTATGGACTTTGTGTTTGGCCTAACGAAAGATTCGGAAGGCAAAACAGGCATTGTGGTCTTTGTTGACCGATTGAGCAAGATGGATCACCTAG
CAGCAGTGCCGGACTCTATTGATGCCGAAGGTAAAGCGAAGCTGTTTATCGACCGTGTGTTTCGACAACATGGTTTGCCAGTGGCAATCGTCTCTGATAG
AGATCCTCGCTTCACTGGCAAGTTTTGGAAGTCCATCTTCAAGGTGCTCGGCACCCGTTTGGACATGTCCACAGTGGATCATCCTCAGACCCATGGTCAA
ACTGAGCGTGTTAATCGCGTCATTAATGACATTTTGCGCAGTGTTTGCGCTGATACTCCTATGCGCTGGAGCTCCATGCTCCCTGTTGTTGAATTTGCGT
TGAACAACGCTGTTCATGCCTCGACAGGCTATACTCCGTTCTATGCAAACGGTCTCACCCACCCTCGCGTTCCGTTAACGCTACCACTATGTGTTTCAGG
GATTGGTGGAAGAGAGTTGCCGATCGACTTGCTGATATCAGCCCTGCTACTGTTCGAAAACAGGTAGGCGAGTTTCTCGCAACGCGATTGAATGTCTTAA
GACATGTGCGTGACGCAATGGCTGAAAGAAAAGACAAACAGAAACAACAAGCACATGCTAAAAACAGAGATTGTATTGAACGTTATCAGGTCGGAGACCG
GTATTACTCGATGCTAAAAACCTACCTACAAATGTAGTGTCCGCAGTCTTCAAGACAAAGTTGCGTCCGCGCTTCATTGGACCATTCACTGTCACTTCCA
AGAAGGGACTTGCGTATACGCTCAACCTTCCACGCAAATTGCGCACACATCCGGTGTTTTACGTGGGCTTGCTTAAGCCGTA