Description :
From Genome Similarity Track
Location :
Scaffold_650:14787- 15872
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_650-snap-gene-0.9Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_650-snap-gene-0.12Hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding / zinc ion binding

Sequence
1085 bases(100 bases per row)
AGCGCCTCTTTCCAAACGCAGAAATCGAGGCAGATGTGTAGCCGACTCAGTGACAAATCACTCGTAAATAGTAGCTTGAAGGTCAATTTCACGCCTTCCT
TGCGATtCTAATGTGTGTTCTCCTCGACACTCTTTTtCCCGTTTCGCCCTCCACGACGACGTTTCTTCTCAATCTCTTTCTCTTCTTCGACTACATGCAT
CACACTGGCGTCTATTCCAATGTCCTCGTTCAACAGCTGAAGCCATCGAACTTGCTGATCACTCAACCGATCGCGCGGACCCTTCACTTCAACAAGCTTC
AGCcCGAGGGCCCATTGAGAAGATATGAGCAGAGAATTCTCGACGAGGCGAGCAACACCATCGACGCcATCTTCGGCGCTAGCATTATCCTCGTCTTTGT
CAATTGCGTCGTTGTTGAGGTTATGTGAGTATTGCATGCCACAGAACTTGTACAGATCAAGCGCTCTATTGTTTGAAGTGTCCATAATGGCGGGTAGGTT
GGAGGTCTTCGCGTCATCTGCAAGACGAGCCCGAATGAGAAGTAAGTCCGGGAGCCCATTTTGGGCGCGGTGGTACTCCTCAGACGTTGTCATGTGACGC
AATAACCGAGCTAAAGACTTCGTTCCCATTGCTGCAACAACGAGCTGGTGAAACAATAGAGGCGTACCAGAGCCCCAACTGACAAAACGTGTGACTTCGC
CGTCGTGAGCACGCCAGGTAGATTCAAGTAACTCCAACACCTGGGTCATTGACATACAGTTTTCGATGTCATCTAGTCTTCTGTCAACTAGTTCACGTCG
CGACGAGTAAAACTCTGTAGCGTAGCCAAAGTCCAGAGGGCCAGACTGATACGCACTCTGGAAAACATCGGGAACTGGGGCGTAGATGATGTCCCACATA
AATAACCCAAAaAGGTTGGTGAGAATAGTACCTTCGCAATGAGTACCATACCAACCTGCTCCGTCGGTCTGCGGGTCGTCGACTTGAGTGCGATAAAATT
GCAGAATAAGTTGTTCGACACCACAGGGCTCATCGTCATACCCAATGAAGCGGGACTTCTCTCCGGTGCTCTTGTTGAGTGGTCG