Description :
From Genome Similarity Track
Location :
Scaffold_468:14782- 16830
Transcript NameFunction/comments
g11355.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569

Sequence
2048 bases(100 bases per row)
CGTCGGCTCCCAGAGCCGACGCGTCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACAAATTGTGTGTCGACATTACCTGTCGACACGACCGC
GTCACCCCGGACGTTTCGAGACCCTCTCGAATCCGATTGAATCAGGCCCTGCTGATTCGTTTCACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCGTT
CGCTTGGGATGACCGGAGACAGCCGCATTCCGCGCTGTCTCTGGTGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCT
CTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGTATGCCCAACACCATATC
GAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACG
ACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCCACTTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACG
CTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTG
ACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGT
TTTTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCA
GCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCC
ACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTAT
TTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGAT
GTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGC
GGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTC
GTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAG
AGGTTCCCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCA
CGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTG
ACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTT
ACTGTCTGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGCCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTC
TGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGTGTATTTAACTTAAGTTCAGTATACTTGTATCCACAAGTATAC
TTAAACTAAGACAAAGGAACCGAACGATAGCTTTGGTGCCAAATGAGA