Description :
From Genome Similarity Track
Location :
Scaffold_447:14780- 16072
Transcript NameFunction/comments
Pytul_var.sporangiiferumfgenesh_masked-pug3_contig_447-abinit-gene-0.26Hypothetical leucine rich repeat protein

Sequence
1292 bases(100 bases per row)
TCATACAGCTGGGTTGCGGTGGATGTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCGCGAGCGTCTTGATCTGCATGCGCGCGCCCTGCTCC
TCATCGATCGTCACGACGCGAGGGTTCACGACTGCATCACTCTGCTGCTGTGACTCGAGCAGCTTGGACTCCATACGCTTGGTGAGCGCTGTCATGGAGC
GCATCGAGTGGACTGAGCGAATGGATTTGCACTCGGAGAGCACACTCGACGCCACACTCTGCATGTCGTCGTCGTCATCATTGCGACCACAACCGGAGCG
ATCCAAGCGCGCCAAGTCGTTTGCATTCAACGCGACGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCGCGCTCACTGCGCTTTTCTTC
GGCTTCTTCGTACTCGACGATCGACTGCATCTGGGCAAGTTGCTGCTCGACCTGCGCCATGCGCGCCTTGATCTCGACGTCGTCCATGAACTGGTCGATG
TCGAGGTTGTTGGCAAAGTCAATGAGGTTGTCGGCTTCCTGATCTTCCATGCACTCGAGCTTCTCGTCCGCCGATTCCTTGGTGAGCGCCCACATGGGTT
TGTTCATCTTGCTGCTCTTCTTGTCATCCGATTCGCTGTTGTTATTATTGCGCACTGCTTCGCGAAACTTGGCCTCGCGCTGTGAAAACCTGTAGAGTAA
AGCAGCAAACGCGTTGTGAGAATGGAGTAATAATTCTGTGAATTGCCAATTCCAGCCAAGAATAAAGACTGGGCGCTTGGGAGACCGCCGGACCTGTCTT
TCTGCTTTTGCTTGTCTGTGTCGTCTGCAACGAGCGCTTCTTGCAAACGCACGCGCTCTTTTTGCAGGTCGTGGAGCCATTTCTTGTGTTTCGAGAGCGC
CGTGTTCTTCTTGTCGCGCTTCATCGCGTGCTAGAGGGTCCAGAGAAACAAAGCTCTCACAAAGTCAGTTTGAATAATATCGCAAAGACTGACTTGCTGC
TTGCTTTTGCCAAGTTTACCCCAGGTTCACTCAGAATCGGCACGTTCATCCCGATCGGTTCGCCGGGGTTACCAGCGAGGAACGCGGCCTTGAAGCTGCT
GCTGCCGATGGCGTCATTGTTGTTGCTCGCGCCGCGACTTTCTTTCGCCAAGGCTGTAATCGTGACAAAAGCAAAGCTAAGATAACGGCCCTGGGGCAAT
AAGAAAGTTGCTCGTCACTTACTGCTGCTCACGCCATTAAACGGTCGGTTGCAGAGCATGACGCCCTTGTAGTTGCCGATGCTGACGGCCGC