Description :
From Genome Similarity Track
Location :
scaffold_1401:1478- 4731
Transcript NameFunction/comments
Pl_100736PREDICTED: similar to OSJNBa0011F23.1 putative
Pl_100737hypothetical protein PHYSODRAFT_499826

Sequence
3253 bases(100 bases per row)
GTGTCCTGTTTGATACTCGAAAGTGACGAAGATGAGTTTTTACTTGGAGATGACGTCCTCAAGCTGCTAGGTATTGATATAGACAGGCAACTGGAACTGT
TAGCAGCACCTAGCAATGAGGATGGAGATGATGATATGGATGTATCTGATGTGGCAGCAGGGAATGATGCAGAAGCCATACGACTTGCAGTAGAGGCAAT
GATCCAACGAGCTGTAGACGAAGGTTTCCCTGCTGGAAAACTCGAGCGACTACGCACAATAGTATGTGCTTATGATGTCTGGAGGTTAGTTCTGGGTAGT
GACCCACCTGCAAAGGTCGAGCCAATGCAAATTAGGATGAAACCTGGTTGTAGACCACACCGAGCGAAAGCTCGCAAGTATGCTCCGGAATATCAAACCT
TCTTGGAGTCTTTCAATGAGAAGCTGGTAAAACTGGGATGGGTTTACGAGAACCCATCCAGTCGTTGGGCTTGTGCTGCCCTACCGGTGCGCAAGCGTGT
GGAGGAGAATTCCGCCAGACTGTCGACTACAAGCCTTTTAACTGTCAGACGGAGCCAATGGCTGGGTTGATGCCCAACCTTCTCGACTTGAAGAAGGTGA
GAGGGAGTCGTCACTTCGGACTTTTTGATTTCATTAAGGGTTACTGGCAGCTCCCACTTGCGAAGGAGAGCCAGGAGCTCCTGTCCTACATGACTCACCG
GAAAATATATACACCGAAACGTGTACCTCAAGGCAGTGCGGATGCAGCCCTACACTTCCAGTCAACAATAGAGAGGTGTTATGAAACACTGCTCTACAAA
CACTTATTAGTTTGGATAGACGACTTGTTGCTATACGCGGTTGACACCGACACGTACATCAACAGATTGCAGGAGCTACTTGAACTAACAGCGAAGTTCG
GATTCAAGTTAAGTGTGACGAAGTCATCTGTATACAAACAGGAGGTGAAATGGTGTGGTAAAGTGATTAATGGAGAAGGTGTGACGCACGACTCAGAACG
CATAGAAGCACTAAGGAATATGCCGTATCCGACTAATGCTGGGGAACTACAACAGTTCTTATGCTCAACGAACTGGATGAGAGATAGTATAGTTGACTAC
GCTCGATTAGCACGTCCGCTGCAAGACACACTAGATAGGGCCATGGCTCAAGCGTCTAGGCGAACAAAGCGTGTGGCATCAGGAGTACCGGTCGCACTTA
CCGCGCACGAATGCGCGGCGTACGACGCGGTAAAGCAAGCTCTGGAAAATTCAGCTACCCTTGCGTTCCCGAAGCCTGAAGCGGAGATGATTCTGCTGAC
GGATGCTTCCGACGCAGGTTGGTCAGTTATTGTGACACAGGTGGCCAGTTGGATAAGTGATGCAGACATCCAGGACCAGAAACATGAACTGCTTATCTGT
CTTGGTGGGTCTTTCACTGGTGCACAGAGGAATTGGAGTATTATCGAAAAAGAAGCATACCCAATAGTTATGGCATGTGATAAGCTCAGCTACCTGTTGT
TGCGCCCAGGTGGTTTCCGCATGTACTGCGACCACCGCAACTTGATACATGTCTTCGCACCTGGTCATGAAGTAAAAAAACATGTTCGTGGAAAACTACT
GAGGTGGTCTATGAAATTGATGGAGTATCGCTATACTATTGAACATATCGAAGGAACACACAACGTTTGGGCTGATATGGTGTCTCGGTGGGCAAGTCCT
CGCCCCGCGCCAAGTGTGGCGGTGAAGCGAGTCACCCTGCGGCGGCAGCGTGGGGAAGACCAGTCTGAGGACACCGCCCGAAGTCGGAACGAACGGAACG
GAGGCTCGGTGCCCGTCCGGCCGTTCAGCGACGGCAACTTCGTTTGGCCAACAGTTGTAGAACTTCAAGCAGCGCAGCAACGACACATTGTGGATCGCCC
ACAAGGGTTGACACGGAGTCGTGTTGGTTTACTGGGTAGTGATGATCGAATTTGGATTCCTAGTAATGAGGAGAGCCTCATTCAGCGACTCCTCGTGATT
GGTCACTGTGGGGTATAGGGGCACCGAGGACGCGATGCTTTGGTGAATATCGTGAATAGGAGGTTCTTCATCAAGAATCTCTCAGCCATAGTAAAACATT
TTCTCGCAAGCTGCCTCATGTGCCAGCATGTAAAAGGAGGGAAGGTTGTAATGAGACCATGGGCAGAGACATTGAGATGCAACGAACGGAATGGAGCATT
ACATTGGGACTACGTGCAACTTGGAAATTCTTTTGGTGACTATAAGTATTTACTAGTACTAAAGGATGACGCTACTCATTTCTGCGAGCTAGTACCGTGT
GCAGTACCGACAGCAGCGGTCACAGCTGAAGCCATTTTGGACTGGCGCAGCAGATATGGCGCTCCGCGTGTGTGGATTAGTGATCAAGGAAGTCATTTTA
AGAACCTAGTGGTGGCGGAGGTTGCAAGGCGACTCACGAGTGGACAGAGATTTACTGTAGCCTACTGTCCCTGGATCAATGGGTCAATTGAAAGGATGAA
CAGAGATATAGTGCAAGTCCTACGAGCTATGTGCCTTGAAGCCAAGGTGGACATCCGTGATTGGGTGCATTTCATCCCAGTGCTACAGTCAAACCTCAAC
CACACTCCGGTTCCGTCACTTGCCAACAAGGCACCGGTGGAACTATTCTGTGTTCTACCTGCTGTATCACCACTAGATTTCGGATTCAATAGTAAAGACA
GCACCTTCGTAGAGTTTGGCACCTCCACGCGCCAGATCGAGGCAAAGTTAGAGCTACTACATGCAAGAGTGCAAGAGATGCACAAAAAGGTGCAGAAAGC
AAGGGAGGAACAAAATAGACGAAATCAGAAAACACAAAGAGGGGCCAAGGTGGCCAACTTCGACGTCGGTGACTACGTGTTGCGGTCCAGGGTGGACCAA
AAGCACAACGACAAGTTGCTGGTTACTTGGATCGGCCCGTACCAGGTAATTGGTACAGACGATCACTCTTTCCGCGTCCAACACCTAGTGACTGGAGCGG
AATCAGACGTACACGCTCCACGCCTCAAGTTCTACGCGGATGCCTCTTTTGAGGTGACTCAGGAGATTCGCGAGCACGTGGCTGCTCAAGGAATCGTCCT
TACGGTTGCTGAGCTAAAAGAGCACCGGTGGAACTCGGCGAAGAAGTGTTACGAGATACTGGTGGGGTGGAAGGGTCTGGAGCCAATTGAGGACTCTTGG
GAGTCTCTCAGTTCACTGTATAAGAATATCCCGGTGATGGTGAAGCAGTACAT