Description :
From Genome Similarity Track
Location :
Scaffold_7:1477644- 1485597
Transcript NameFunction/comments
Physo_250605ATP-binding Cassette (ABC) Superfamily

Sequence
7953 bases(100 bases per row)
GTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTT
TGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTTGTCAATCCTACGCCTACGCGGGTAGATTGGACTACC
TGAATCCTCTGTGGTCTCATCGAGTGAGCCAAGATGGGTTGTACGGAGTTTCCCGATCTGAACGACTCGCAGTACGAGTCCGTTCGTAAGATGGCAGGCA
TCTTTGGGACAGATGCCCTGCGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGAGGGCTCATCGC
CCACGTTCAAGGGCTGCAGGCCACTGCGGCCGCGCTGAAGCCGGTGTAACCGAAGCCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAA
AACATTCACTTCTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTG
GTCGCGCTAAGAGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGTTTCGCATCATGGTCCCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTTCC
GGCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAATGCGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCACTGCC
TCTTTGGTGTAGAACCCCCTGCCTGAACACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAG
CAAACACTATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCCGCCACGGTATGGCAGAGTAACCCTGCCTC
TGGCGGTGCGCCTAATGGTAACTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCATGGATCTGGGCATGGCCGAGCAGAGCGACATTCGTTGCTACGGC
TGTGGCAAGCTTGGGCACATGAAACGTGCTTGTCCCGCGGGAGGACTGAAGAAGAAGCTCTCTTCGAAGCCCTTTGGCTCTAGAGAGTCTCGGTACTCTC
GAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGATCATCTCTTGAGAATCTTGATCGACTCTGGGGCGTCCAAGA
ACTTTGCGTGCCGCCAGACTGTCGCACGCAATCGCGACAAGTACGCCGATGCGCTACGAGGCAGCAAAGGCAACGGGCTGGTCTCGGTAAGACTGGCCGA
CGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGTCAAGTTCGAGGACTTCGACAGCACGGAGCCGTTCTTGGTCCTAGACATGGACAAG
TACGACTTGATCCTTGGCATGCAGTGGCTGGAGAAACACGAGCCTTGGATCGACTGGCGCGGCAAGGCCATCGGGGCCAGCCGTCCCCCACGCTCTGACA
GAGCTTTGGTGAGTCATGTTCCCACCTCTGGCAGCAGCTGGGGCGCCCGCGAGGGCCGCCAGGGCGCAGCAGCGTCTAATGAGTTCTTGGGGTCCGTCGA
GACTGACGACGACTCCGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACCAGGTGGGTAACGTAGGTCCACACGCGGGTAACGAA
GTACCGCAGGCAGCAAGGGCTGCAGGAGAAGGCGCCGCTGGCGTTGGCGTGGGTAACCAAGTTCCACGCGAGGTCACTCAGATCGTAACTGATGAGGAAT
GCACTGCAGGCGCTTCCGATGTGGGTAACATAGTTCCACAGGAGGTCACTCAGACCATAACTGATGCGGGAGTCGCTGAAAGCGCTCCTGGTGTGGGTAA
CCAAGTTCCACACGGCGAGGTGGGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGCTCAAGGACAAGGCGGGTAACGTAGTTCCGCACGAG
ATCGAGAAGATCGGTGGTGGCGCCACGAGACGAAGACACCCGAGGGTCACGTCGTAAGCCGGGCCTAGTCGTGTGGCCGACGACGCCAGTCGCCAGCGAC
TCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGCGTGACCGGTAGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAG
CTCTGCCCGAGGTTTCAGAGTTGCTGAACCTTGAGGAGCTCGCCATGGAGGACTTCTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCT
CCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGTCATGGACCAGGCAGTCCTGGAGGAGTTCCAGAGACGGCGCGTGTCGCGCATGGGCTCT
GAGATTCTTAAGAACCCCCGGGACCCGGTGTACCCCTTGGTGAAGAAGTTTGAGGACGTGGTGTCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGG
GGATCAGGCACGAGATCGATCTCGTGCCGGGCACGAAGTACTGTGTCACGAGGCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTT
TGCCGCCAAGGCGAAGGCAGGCATGGTGCTGGAGTTGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTT
CATGCTTATAACAAGCTGAACAGCGCGACAGTGCCTGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACAACATGGCCGGCTGCACGCTGTATA
GCGCGCTGGACCTGGTGGACGGATACTACCAGATCCTGATGCGCGAGAGCGACATCCCACTCATGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTG
GCTGGTCATGCCTCAGGGGCTTTCTAACGCCCTGGCAACGTTCAATCGCTTGGTCACACAACTGTTCCGACCTTTGCGTGCGTTCACACAGACGTACTTT
GACGACATCTTTGTCCACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAGCACCTTCGACGTGTGTTCGAAGTCATGCGGGCGAACA
AGCTGTACGCCAACACCGACAAGTGTGTGTTCGCAGCTGAGGAGATCAAGGTCCTGGGCTGCTTCGTCAGCAGCAGCGCCGGGATCCGCGCGGACCCAGA
GAAGGTGAAGGTCATCGCGGCTTGGTCGCCGCAGAAGGACCTACAACAGTGGTTGGGCCTGGCCAAGTATTTGCACAAGTACTGTGCTGCTACGCCGGGC
TGGCACAGCTATTGTCGGATCTCCTGAAGAAGGATGTCGACTGGCGCTGGGAGCGTCGCCATCAAGATGCTTTTAACGACATCAAAGCGAGCTTACAGCG
CGCGCCAGTCCTGGCATTGCCGGACGAGACGAAGCCTTTCAGCGTAGTCTGTGATGCGTCTGACTACGCAATTGGCTGTGCGCTATTGCAGGCCGGCGAT
GAAGGCCGCGAACGGGTCATCTCGTTCCAGTCCAGGCAGCTCAAGGCAGCCGAACGGAACTATCCAGTCCACGACAAGGAGCTACTTGCCATGAAGTACG
CTCTTGTCAAGTTCCGAGTGCACCTCCTGGGCTCGACGCCCTTTGTCGTTTATACAGATCACGCGTCCTTGCGGACTGCCGTCAACACGCCGCATCTCTC
ACAGCGGATGGCGCGTTGGCTGTCATTCTTCGCGGAATACAACTTCCGTGTCGAGTACAAGCCGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGC
CGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACGACGGATCTGGATGATCGCATCAGGCTGGGGTACCGAGACGATGCCAGTCTCGAACCTCTTG
TGCGGTTCTTGGCCGCTGGCTCGGAAGCCAAGGCCGAGTGGCTCACGCCCCGACAACGTGCAAGGCTGCACCGCTATGAGTGGGCTGACGGTTTGCTCCA
CTAAAGGGTCGAGCCCGAGGATCCTCCCTGTATTGCCGTGCCCAACGACGAGGATCTCAAGTACGACATCCTGATGGAGGCGCACGACGCTCCATCCAGT
GGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCGCAGATGTTTTGGTGGCGTCACATGTACAAGTGGATCGCCACCTACGTCCGTACGTGCGAGA
CGTGCCAGCGCGTGAAGCCTGCCGGTCACGCCTCGGCACCATTGCAGAGCCTGCCGGTCCCAGCGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTT
CGGACTTCCGGCCGATGACCGTGGCAACACTGGTGTTGTTGCCTTCGTGTGCCGTCTGAGCAAGATGGTCCACTTTGCTCCAGTTCGTGACACCGTCACT
GGCGACGAGGTCGCTCGCCTGTTCATGGGCTGTGTCTTCCGACACCACGGTCTGCCCGAGACCATTGTCTCTGATCGAGACCTGCGGTTCACCGCTACGT
TCTGGCAGACGATGTTTCGCCTTCTCGGCACACGACTACGGTGGACCACCCGCCGACGGATGGCCAGACGGAGCGCGTCAATCGCGTGCTCGAAGACACG
CTCCGCAGTATCTGCGCGGAGATGCCCCGCTCTTGGGCTGATCGCTTGCCTATGGTTGAGTTCGCACTCATCAATGCGGTACATGCATCGACGGGCTTTA
CGCCCTTTTACCTGAACGGGTTGCGTCACCCTCAGGTGCCGCTCACATTACGAGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAAC
CTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCACCTTGCGGAAGCAACTGTCCTCGTTTGCCGAAGACAGGCTGAACATAATCAGCAGGGTGCGAGAC
GCCATGGCGCAAGCCCAAGATAAACAGAAGGAGTACTCTGACCAAATGGAAGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAG
AAACCTACCGCTAAACACTGTTAGCTCGGTCAAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGGCGCGGCGTAC
ACCATAGACTTGCCCAAGTCGATGACGACTCACCCGACGTTTTACATGGGTCGTCTTAAGAGGTACCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAG
CGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCTCGAAGCGCGGCGTCGAGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGCGCGGCG
TACATCGGAGCAGCATACGCAGGGGCCCCATACGAGCCCTGGCCAAACTGGGCCTGATACGAGTGGGGCAGCTGCTGCTCCGGATACGGCGCGTGGCCAT
GAAGCTCGGCCCGAAGGCCAGCGAGCTGGTTTCGCAGCGAGTCATAAGACGACAGGTCGGCTCGACGATCCCCACGGCCATGGAGACTGCGAGTTTCTTG
ATAGAGCGAGGCAACATCCTCACGGAGCCGCTCCACGGCACCAAACTGACCAGCACGAGCGGCAGCCTCGCCACCAAGGCCGACGCCAAGCGCGATCTCG
AGGACGTACACACGGTCCCGGAGAAGACGAATCTCCTCTTGCTGCAGGGCCACCACCTGACTCGGGGCCCCAGCATACGGCTGCGTCGCCTCAGGCTCGG
AGCCATGGCCGTGCGAGGCTACCGCCGGCCCTCCTTGATCGTAATGGGCAGATCCACTACCACGTGGAACGAGTCGTCCGGGCGCGGCGGCTCCATGGCA
AGCGCCAGCTGCTCGTGAAGTGGAGGGGTTACCCTGAGTCGGATAACTCGTGGGAGCCTGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTTGCGAT
ATGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGGCCGGTACCCGGGGTACGGTAGCAGGTAGTCGCACCACGCCCACGCTCTTCA
CGAGCTTTGGCTCTCGCCTCTTGCTACAGCTCGTCCATTTTCGAGTGGAGCTTGCGCTTGCTCACGAGTTGACCGAACTCGATGCGGAGCTCGCGCACGT
CCAGGATTGCGGACAGAGTGCGATCCTCACGGAGTTCTTTGAACTCTTGGTCGGAATACCCTTTGCGCTGGACGGAGCGCCAGAAGAGGTCTTCCACCTC
GCTCCAGGTCATGTTGTCATTCGGCTTGACCCAGTGGAAACCCCACACAGGATGGAGTCCACCGTTGTCCTCCGGCTTCTTGCGAAGCGTGGTGAACTCC
TTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACTCACCGGGCGACTTCAACGTCGCCAAGAAAGAGTGGCCCTTTCTCAACAAGAGCACGCTCATAGGAAC
CCCTCGAGGTTTACCCGCCGATAAGGCCACGAGGAGCCGAGAGCTTCTCCAACAGCGCTGGCGCGCCAGTGCCAGGCTCGGGCGGGAAGTAGCCCTGTGG
ATACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGCTGCAGTCAGCTGCCTGGCATACGCGCCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGC
TCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCACCCTCCTCGTCCTCAGACTCCGAGTCGATGAACGGCTTGGAGCTGGAGCCGCGAGGCG
ACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTCGCAGCGGCAGCCGCTTTCGACGCTAGGACACGCTCACGACCTTGTGCCAGCGTCAG
ATGCTTGGATGCCAGCACCGCCTTGGGCTTGGAGCCCGCGTCGCTCGGCGACTTCTCGGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTGCGAC
TGCTTGCTGTCGCCTGAGCCAGACTCGGCGTCCTCCGCCTCCTTCTCTGACGAGGCCTTTGCGTCGGCCGAGGCGTTGGTCATGTCGCCTGCCGCCAGCT
CCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCTGAGACGTTCTCGTCGTCGGGTGAACTCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGACGGC
TTCCCAGCCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGCCTTGCGCGGCGTCAGGAGACTTGCTCCGAGCCCCGGCCTGACGGCCACTC
TCCGGCGTGCTGCTACGAGAGCGCACCACCGCCTCGGCCGCCTTCGTGGCCTCCATCAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCG
GCCCTACGGCCCGCGGTTTCGGAGGTGCTTTCGCACTGCGCGCACTGCGCTTTGGAGGCATGCTTTCGGTCGACGTGGAGACCCTGTGGCTTGCTCGGCG
ATGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCCAGAGCTCGCGCCGTTGTCGATGGATTTCGACTTTGCGAGTGAAATGTGAGTCGCCGGCGT
AACCTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGGGAGGATGTAACGGGGTTACATGGAATAGTGACCCTGTCACTATTCCGGGATGGCTACA
TCGGTCACTCCCCTGGTTAGTGACCCAAGTGGCCTCAGAGCCAACAGATACATTTTGTATGACACAAACTATAGGGAACTTAGGATTTGTATGCAGGCCA
AATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTG
GAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGAGTGCCCCGTCACA