Description :
From Genome Similarity Track
Location :
Scaffold_23:147762- 150386
Sequence
2624 bases(100 bases per row)
GAGACAACAGAGACATCGAATGTCCTAATAAATGATGGATCAAGTATAAGTGCTTATAAACTTGATCTGATCGCGCCTCCGAAGTTAACTTCCGAGATCA
CTCAGTTGCCCACTCTAGAACAAAAGAGGTTCTTGCATGATATGCGTAGTGGCAAAGTCAAGCAGATATGCGTACTAGTCGCGGGAGATGAATATGCCAG
TGATATCTGATCGGCAATGGACTTTGTCGAGGGTGAAAGAGTTCTCATTAGTTCATCAACGGACGAGAGTGTCCTTGATGAGAAGACTCGGATTGAGCGA
TATACATCCCAATCGTGGGGTTCACTCAAAGCAAATCCTCTCTACGATGATTTGATAGAATTCAGGGATCTATTCCTGGAAGCAGTGCCGTGCGAGTTAC
CTAAGGACAAAGGTACTCGTCTCGAAATCGACCTGAAACCGGGTTCAAAGAACTGTGTCATGAAGCAGTGGCCAATGCCTTGTGAACAAGTACTAGCAAT
CGAAAAATGCTTTGCAGATCACTTAGTGTCCGGCCATGTGAGAGAGTCGACCTCCCCACATAGCTCTCAGACCTTCTGTATGCGAAAGGCCACAGGAGCA
TGGCGGATAGTGCACGCATTCAACAAGTTGAACGCTGTAACGGTACCGGATCAAAAACCTATACCCAGGAAAGATGTTATCATAGATGGTATAGCAAAGG
GTACCATCTTTTCATCAATGGATATGATAGACGGCTTCTATCAGATCCTTATGCCCAAAAGGGACATCCGATATACCGCAGTGTGCATCCCAAGCGGTAT
GCTTTAGGAGTGGCTAGCAATGCCACAAGGACCAAGCAATGCTGATACATGTAACATATGTGTGACAAATCTGTACGAGACTTCTCACCCAGTTACTTCG
ATTATGTGTTCGCCCGTAGCCGGGATGCGGACGGAAAGACGGATGTGGAATTACATCGACTCCACGTCCGGAAGGTTCTGCACTCATGTGCGAAAACATG
TTGTATACCAACCTCAAGAATTGTATATTTGCTGCTAGCGAAATACCACTTCTTGGGTGGCCCGATCCGGAAACGATTGAGGCGATCACCGACTGGCCGG
TGCCTGCGGATGTACAAAGACTTCGAACGTTCCGTGGTCTAGCGGCGTATTTGTACAAATACTCGCATAATTACGCCGTGATGAATGTTCATCTCTCAAG
TTTATTGAAAAATAAAGAGAATTGGGTATGGAGTGCCAGCTGTCAGCGCTCCTTCGAAGATATCAAGAAAAACTTGACACGGTCGCCAGTTTTGGCAATT
GCGGACCAAGGCACGCCATTATATGTGATTTGTGACGTCAGCAATTAAAAAATCGGATGAGCATTAATGCAGTATGATGCAGGTGCGGAACGCGTCGTTT
GCTACCAGTCGCGTCAGCTAGAACCAGCAGAGCGTAACTGCTCCGTCCATGAAAAGATAAATTTTGCCATGAAGTACGCGTTGGCGAAGCTCAGGGTATA
ACCGTTAGGTGATAGACCCTTTATCGTCTATACGGACCATGCGTCATTACATAAGGCCGTAAACAGTCCTCACCTCTCGCAACGAATGGCAAGCTAGTTG
TCATTCTTCGCGGAGTATACATTCTCCGTAGAGTATAAACTAGGAGAAATCAATTTCGTCACTGTCGCGCCAGCCCAATTTTGAACCGGCTGTGCAACCC
GACACCGGCATAACCACTGATGCGGTATTGAACTCAAGTGTACCGTCAATAACCTTACTGGGAAACATACGGAAGGTGTATGATTCAAAGATTTTGAGTA
TGATGAATCATCTCTTGCAACCTTCCCGAAAGACCCTGGACGAGCTGTCAGTAGTATATCGATCCTCAACGGATAGAACGACAGTTTGCAACGACTTAAT
GAAATATTGAGTTATTGCCGGCGACACGAGGCGTGTCGCCGTCCCAATCATAGTGGTCTGTAGTAGAGGATCACGTATGAATACCACGGCGCACATTTTG
GTGGACATCGTGGTTGCGAGAAAACATATCTCACAGGGAGCCGAGGCTTCTACTGGACTCGTCAGTATCAGTTCGTGTGCACGTACGTTCGTGCGTGCGA
GGTCTACCAACAGGTGAAGTCTACCCCTTCCCTTCGTGACTCGTTGTAGCCTCTGCATGTCCTGGCTGGGTGCTAGAAATCCGATTCGATGGACTTCGTC
TTGGGATTACCCGCCGATTCTCACAAGAACACTGGTATTCTTGTGTTCGTTGACAGGTTCAGCAAGATGTTACACCTGATCGCTGTACCCAAATTAATCA
AAGCATTGAGCTGTGCTTGAGTCTCTATCGAAACGATCTTTCGTCTTCATAGGATGCCTAGTGAACTCGTGTCCGATAGGGACCCGCGGCTCACAGCTGA
GTTTTGGCGCTTCGTGTTCACCACACTCGGAACGCGCTTAAAGATGTCCACATCTGACTACCCTGAAATGGATGGTCAGACGGAATGCGCCAACTGTGTT
CTCGAAGAGATCCTTCGAGGGTACGTCCGTTCGTTCACGATCTGGAGCGAATTCTTGCCTGTGGTGGAATTCTCCATCAACAACTTGGTACACGCATTAA
CGACGCATAAGCCATTTGTAAATG