Description :
From Genome Similarity Track
Location :
Scaffold_79:14776- 19590
Transcript NameFunction/comments
Hyaar_Emoy2808330hypothetical protein

Sequence
4814 bases(100 bases per row)
ACATAATTTTCCAGTCCATAAAAAATGGGACACAGTAGTATAGTTTTAAAAACAGAACTCCCTTCATCCGCTTTTTAAGAACGGTACGGGTAGCGGAACC
CCAAATGGTCGACAGTATTCTTTTAAAACATTAAAGCTTTCTTGCCCCATACTATGATGAACGGCTCGCGTTTGTCCGAGCCATCTTCATTGCTATTCAG
AGCGATGGTCACGCAATTCTCGCTCTTCTCCAATCATTCACTTGACGACGAGTGATGGTCTCGTCGGTCGCGAGGCACTCATAGAGTCCAGTTTAACCCA
TATTGTGTTATATGCCAGGTGTCGACACAGCCTTAACAGACCCGATATCACTGTGAGCACTCATTTAACTAGACCCATGGCGCTTCTGAAATTTCAAGTG
CCAATAATTAGAAACGGCAATAGCTTGTCGTTAGGACGCCGACCAGTATTTCAAACCGCTTTACTTCGCTCTAATCAAATCTCCACTCAGCATCATACCC
CCTTAATTGGCGCGCTCTTTATATACGGCTAAAGTACGAGCGTTTACGTTCCCTTGCACTTAAGGTTTATTTCTTTCACACTTACTATGGTCACGCAAGC
TTTTAGTCATCGTTCCCTGGACCGGCGTCTTAACGAGGTCAAACTAACTAATAATGACAAATTGCAATGGAAATTTGGTTACTGTTATGCATAAATGCTC
GTGTTGAACTCTATCATTGCATTTGCCGACTGCAAAAGCAGTACCTCCATTCCACGGGCAGATCCTTTTCTTCTAGTCGAATATCATGTTACCAACTGCT
TTCAACCGTGACGGCATTGTAGTGATTTATGTGATGTACCTGTCGAACGGCTTGTTTCTCGTGGGCAATTTTTTTACACACCATTGAGTTCATTTATCTG
TGAGTTGCCACTCACAGATGAATGACTTCAATGGTATGTAGAAATTTAAGCATAACTAAATAGCATTGACACCTGTACCATATTATAATGATCTCCTATA
CATGATGAGTGGTTATCCAGGGGTCAGATCACATTTGGGATATTTTTAACTGTAGAAAGAAATCATGTTTTGTGCGGCTACTAATACGCTTGTAAGATTT
CACTTGTTACGCGAATCCACTTTTTTAGGGTGAGTCATTTGCTTTTTATTAGGATTATCCCGAGAACTATCATGCAAAAACTCACAGCGTGTATTTAATG
ATCAGCTGGAAATGATAGAGCAAGGTAGCATCGTGAAGATTGCATATGTACGAATAATCAAGTAGCAAAGTCGAGGCAACATGACACGCATAACGCATTT
TCCCCGATACACTTAGAAAAAAGAACAAATAAGAAAGTTTGTGGTATCCCTCCTCGGTCAGTATTAGAGGAAGCCCCCTAAGTTTCTTCTTTTCCCATCC
TGTACCATGCCTCTGGTCGAACATTGTTGCTGGTGACAGTTTCAAAGGCAAATGATCAGTCGTCGTCTTCCTCTTTTTTAGCGTTCTCCTTAACACATCA
ATTTCACCAACGGGTTGCCCATCACACAACTACCTTGACGAAAATGACTCTTATACATCTCACTATCCACAATTTTAGGCCCCAGCCTCCAACCTATATC
ATTCGAAATGTTTCGTCAAAACTTACGAATGAATTTGGTTCTTAAGACCAGATAACATAAATAATAAGGCAAGACATAGAGCTTGCTTCTCTGTGCTTTG
TATGTATTGACATATGTACTTATTTTCCGACATGCGATCGCAACGCTTGCGGGAGATAAGATTTCCTAAAACAATGTACACGAAAACGATTAAGCTAGGC
AAATGCTAAACGGCTCCGTTCATTTTTATTCGGTTGTGTCATTCTATAGGTATAGGGTAAAATAGTCATCGTCTAAACGCATGTTGTTGAATATCGCCAA
ATTACTAGCTTTTTTCAAAATACGACTTTTGGTGACCCTTCGCCAAAAAGGTTTTTTTGTGATTAGCTCTGTCGTTTCAGCTACGATGTACGATTTTTTA
GAAATTGCATTTCTGTAGTGTTGTAAATTTGATCCACACAAGTTCTAAACTCGATAAGAACATCGGATCAGCATATACCACTTGATGTAGACTAGTGATA
TTGTGCTACGTATTTTTGTGTCGGCGGTGACAACGCTGCCTTCCAACGCGACATGCTTCGCACGGCGGAATTTTTGTCCTGATAAGACCATTCCACGAAC
ATAGCCTTGATCCGCCATAATCCCTAGATGATTTTACAATTATGTTTAAGACGCTTGTGCCAATGAATCATGGGAGCCACACCGTCTGCCCTTAAATAAT
TTGATTCTGCCTAAGGTAACTCTTCCGTCATCATATATTCAATTAATGGGTCCTCCGCATGACATTCACTCTCCTTATTAGATTATAACACACTTGCGTT
AAGAATTGGTGTCGCGCTTCGCGGTAGGTGTGTCGAGATCCTCCACATTCCGTCATGGTGCTCTGCTCGGGACATTGGTTGTTCACAATAATTTATCATG
AAACTTATGATAGACGTATCTATTGTCATGTCAAATCCTTGCTTTAGTGCCTTGCCTGGGGAGAAAAATCTCTATTCCGCATATGAGACGTCCAACACGT
CTTCGAGCAGAAAGCCTTTTTCTTTCCCATCGACCAATGTACCCATTTTAATTGAAACCGTTCTAGTCCCTCCTGCATTTAAAGCTGTTGATATACCCGC
GAGGCTGACCTTTGACTCAGGTTAAATCGAATTGTAAACGGCAAAGTCGGCTCGATCGGCTGGCACATGAATATTTTTACCGTTGTCAAAACACCAGATG
TATGTGCCTGTCTGTGATCCGTCTTCCCGAGGAATTAACTCCAACTTCACCTTTTGCACCTCATAATCTTGGATGCGACTATTGTCATCATTTTCCATTG
TGAAATCACATATTTTAGTTTCACGATCACAGACTTGGTTTCGCTCATTGACCATCTCCGACCTCGCCTTCTTTGGTTTCTTCGCAAAATATAGGCGTGT
CTTGGGCGATTCTTTCACAGAAGCTTCATTACGGAAACGTTTTAAATTACCTGGATTGCCGCACTTGTAGCAAGTCCTAGTTTCATTTGCTATCTTCACG
TTCCATTTTGTTCTTGATATGTTTGCTGCCTTTTGTTGCCTCTGCATGTTCACCTTGTACGTATCCTCCATTAGCATATCCCTTTGTTGTCCGTCTTATC
TGGTATCTTGATCTTGCAGCACGAATTTGCTCTTCCAAATCATAGGTAACCTTAGCTGGTTCATTTTCGAACCAGTTCTGTTTAAATTAACCCAAAACAT
TCTGGCACTATGCAAGGTAAACTCTGTAGTATGTGCATCATTTTAGGTAGTAAACGAGAGCTGGATTCCATAATCATCCAGCTCGAGTCCTTGTTTCCCA
TCTTTCGTAGATGATCCTCGATGTCGTCGTCCGTGTTGTATCGCACCCGGCAAAGCTCTACTTCAAGCCTTAGGACAGCATGGGAGGTAGAAACGGGTTA
GATCTATTCTCAAATCGCTTACACAACGTCGCAATCAGAGCGCGTCCAGTTTCCCCTGACCTATACAGCTCCGCCAGCCTGTCGAAAGTGACATCATTAT
CTCTCGTCGAAGTCGCTGCCAAAGAATTTTTTGATTAACCTTGCCTTCATCAGTTGAGAGATACTTCCGGTCAATGTGGCTGGATGCAATATTCCAAAGT
TCCTAATCTATATCTGGTAGCGCTCTTATTTCCATCTCCTTGTAGGTATGCCAGTACTTACCCTTAAAGTAGTGTGGCATTCTATTCTTCGGATACAGCT
TGTCAACCAGTTAAGGGACCGTTGTTGTGTTAATTTGGGTTTGGGGGTAGAATGATAATTGTGTATTAAATATATTTAGGTCCCTAGATCGCAATCTCTT
CTTGCTAGTCTAGACCTACTGGATTATAGCAACTATGCATTCATGATCGCTGTATCGCGCATAACTAGTTTCCACATCACACATTACTTATCGTCTAGTC
GTGCATTGTAATCGCCACATCGCGCATTAGTAATTGTTTAACCATGCATTTGGTTGCCGCTTGCATACATAGATACTTTTTCGACAACAGTTACAACCAT
ACATGTTTTGATCGTAAACATGTCCGTAATCGTATACGCAATGAGCGGTGTTATATCGACACTACTAATCACCGCTATTGTTGTATGCGCTTAGGTCCGA
TTCCACTGGACTGCAGTACGTATCTATGTCGTTTGGTCCCTAGAGCCTTCATCAGCATGTCTGCCTATTATTCCACCTTAGATACGTACTTGACCACAAT
GACATCTAGAGTCATGTTCTCCCGGATAAAAGTGATGACGAATGTCGACATGCTCGGTCCTAACATTGTATCCTGCATTATTGGCAAGTCCAATTGTTCC
CTGATTATCTTCCCAGATCAATACTACTCTCACTGGTCATGACCGAGATCCTTTAGTATGGTTTGGACCCACAATACTTGTAGGTACACAGGGTCATAGC
CATGTATTATGCCTCTGTCGAGCTTTAAGCCACTGTACGCTAACGCTCGACTGAAACGACTGGTGCGCCACCANNNNNNNNNNGAGCCACTTCGTCGATA
TCCTTGATCGCATTGATGACTTCGGTCTCCTCCGTAATGGACGTACCATAAATTCTAGTTTGCCCCTCGTTCGTCGAGATTCACCAATCATGACACCTTG
ACCTTCTCCAGCTCCACATCATACATGCGATAGCCCTATGCATTGTTGTCATAGACAAGAAACATAAGCTTTAAGCTCTTTGGCTCCAGCTTGGTGCGGT
AGAGTCGTCAGCAT