Description :
From Genome Similarity Track
Location :
scaffold_289:14773- 16937
Transcript NameFunction/comments
Pl_106522casein kinase II subunit beta
Pl_106523hypothetical protein PHYSODRAFT_305491

Sequence
2164 bases(100 bases per row)
GCCAGTGTAGTACTCGCTGGAGCTGTGAACCTTGTAGCCGAACACACGCGGTACGTACGTCTGCGTGGGCGGTGGCACCACAAGGTGGGAATGCGTCATA
AGGAACACATGCGGAAACGTTGCCCCAAAGTACGCGCCATCAATCTCTGCAACAACAACAAACAACATCAGTCTCCTTCTTCACTCTACAACCTGAAAGT
TCTACGTACGGCCTGCTCGTTGCGACTTGGGGAAGAAGATGTCACGACACTTGGGGCAAAAGACATTGACTGTCGTGTGTCTGGGCACATCTGACTGCCC
CACAGGCAGTACAGGTTGTCCTTGACAGTACACACGATGACAACGACCAAAGTCTACGTTCTGGTACTTTTCTAACATGGCAGCCATGCCTTTGGTGGTC
AAAATGTAGCGTGCATGGATGAGTCCATAGAGCATCTCGGCTGCAGACTCAATCATCTCCTGTTGGATCTGTGTGAGGCTGCTGTCGTTCGGGGTTTCAA
TGTCCAAGATGATGTCCAGTGCGTAGTCATAGTACGGCACGATGCTGCTAAGTCCTGTGAGGTTGAAGTCGTCCTCAATGTAGTCTTCATCTACCTCACA
GAGGAAGCTGTTCTCCCTCAAAGAGCAGAACCACGCGATCCAGCTCGTCTCCTCCTCGTCACTGCCCTCTACGTCATTGTCCTCGTCGTCGTCATCCTCC
AGAGCACTCGAGTCTTCCTCTTCCTCGTCTTCATCGTCTTCTGAGAGACTGGCAGATGCACGTGCAGCCTCAGACACACGCAGCTCCTCCATGTGACCAA
ATAGTCGCTCCATCTCGGCCTCCTCCGCCGCTTGACTGCCGTTAACAGGGTGATCTACGGATTGACTCATGGTCTGTGGCCTTTAGACGCCTGAAAAGGG
TGAGAAGCACTGCGATAAACTCGTCAGCGTCTCGGGATGACTCTGCTACTGGTAGGAGACGCCGATGGGGGACCTAAAGCGCGCAATTCGACCCTCTACG
CTAGCCTATCGAAGGTCCGCCGTCGCTTCTTCCCGATTTTAGAGCCAAGCGCTGGCTTTGGTAAGTGTACCACTCAATCGGTACATTTAGTGTGGGACAC
AGCACTGTAGCCATTTCAATTATTGACATGGCGGCAGCAGATCGCTGGTATGAAGCGTATGCATCGGGTGAGGAAGCAGATCGGAGAGAAGAAGGAGAGA
ACGAAGAGCAAGATGAAGAAGAGTATGAAGAGGAGATCGAAGAGATAATAGACGACGAGCCCATGCACGTCGTTGGCCGCCTTTACATCGGATCTATTGA
TGCTGCGAGGAATGTCAATGCTTTGAAGCGACTGAGGATTAATGAAGCACTTGCGTTGCTTGGTAAAGGAGAAGAAGACGCTGCAGTATCGAGTTATTTG
AGTGTAGTGGAGGAAGAGTATCCTGAGCTGCAGATTACACGAAATATTGTCGAGATTGAGGACTCGAAGGACGGCCACTTACTGCAGAGACTACCCGGGA
TACTGGCAGTGCTTGGGAAGCTCATGTAGGAAGCTGTGTTTGATGGAGATTTCTATAGATTTGTTGACTTATTGGATGCTAAATGTGACTGGGTAGAGAG
ACGGCAGAGCGGGACGATATGAGAGTGCTGGTCCATTGGTAAAAGCAGTATCGACTTGCTCTGGTAGGGTGTTGATTTAAGTTGCTAACTTGTTGTGCTT
TTGCATGACAGTATTGCCGGCAGATCACGTTCCGCCTCAGTACTGGCAGCATGGATGCTAATTAGCGAGCCAAAACAACAAAGTGTACAAGATGTTGTCG
ATCGGATCAGGTGGGACCAGCGCTACACTGTTATGTGAGAATCAACACAAGCTTACAATTTTTTGATCGACGTGTGCAGGATCGTCCGACCGTGGATTGA
GATCAATCCCTACTTTATGAAAGATCTGCACTTGTTTCATGCTGTACTCACATTAACAGATGGAGCGTCGCTAAGTACAGAGAATGCTGCGCTACTGGAA
GAGCATGCATTTCCACGACTGGACTTTGGCGCTGACTTGGTCGAAGGGATCCTTGACGGCACAAAGACCATCACGATGCGTCTCCTATCAGATGTCGAAG
GTGATCTCAAGTCGGACTTGAAAGACATCTTTTCATACTCTATCGTAGCTGCAACGACCGCAAG