Description :
From Genome Similarity Track
Location :
Scaffold_27:147722- 150215
Sequence
2493 bases(100 bases per row)
CTGTTGCTGTACCTCAACCACATGAAAAGTCTAAGAGCGTACCGCCCTTAGGACCTTTCCCGGACTTTTCCGTGTCGTTACACGAAACGTCTCGTGTACG
TTTGACCCTGTTACACCACCCTCCGTTTCAAAACGATTGTTCGCATTCTGTGAAAATCGCAACGAAGGAGAAGCATTATACAGTTATCCATCAAGACGTG
CCGCTTGCCGTCTGTGCTTGCTTGTTCGAACTGCGTTTGAGTGCAACCGCTTAGATTATCACCGCTCGGCGTTCCCATGCCATCTAAACGTGAGAGGGAT
AGTGGGTCACCTGAGACGCCCACATCTTCGAGCACTAAGCGTGCACGTTGCGATGAAACGACGACGGCACATTATGCTTTTATCACTACGCCAACCGCTA
GTACATCGGTCGCGTCGTCGATAGGTCATGCTGGCTCATCTTAGTATGTAATGCTGACGATGACCCTGAACTCATGGTAGACTACATTGAGTCTACTACA
TTGCTGTTACTAATGGATGATGAAGACAGTGAGCGCATATGTGGCATGGGAATGGTCTGTTGACCCCATCACAGATCCACAAACTGCTCCTGTACAAAAC
CTACGCGATATTGAGTGAATGCACAATCTACCGACAACAAGGTTGTTCGTGATGCATCGGCTACTATTACCTTGAAGATCTCAAAAGAAAGCATCATCCT
TGCAGTATCAGCCACCTGATCACGTGTAAACGTCTCGTCTGAACGTAAGGGCATTTATAATTTAGAGTCCAACTCCGACGAGCCAGACCACAAATCTCCT
ACAAGTACACTGGACCTCCGTCGATTTGTGTCGTAAGCTCTCCAATCTGAAGGCCACGTTACAACTCTTAACATTCCACCGATGCCTCCTCCAACCGAAT
GGTCAGTGGCGTTGGGTCGGTTGCATCGCTTTTAGCGCGTGCAACCATTGACGCCCAAAACGTTTATGTCGTCTTTCGTACGTGGATACATGAAGAGAGG
AGGCTTGACCGTACCTTCCCAATTTTTGTTGTGTTGTTTCCCAACGAAAAACTGACCAATACGAAGCAGCATTCCTGAATCGTACCAAGCCACACCCTGA
GGCGGAGAGGCGGCGGTTGCAGCGAATAAACTTTGCGCTGGAGCGTGCGCGTAAGATTATGGGTGGTAATATACCCCCTGCATCTTCACGTTACGCTGAT
GACGCTAGTCCATCTGGATTTAGTGGAGCAGTGCAGCTGGTATGCCTGTTCATAACTGACAGCCGTTCCAGGAACGTCGACACGCAACGCGTCAATCGTC
TCCCAAGAGTCAAATCTCTGAGGATACCCTTTTCCTTGGACAAGGATTGAAGCTTCTGCTTCCTTCCCTTGTCGGCTGTCAACCTTACTACAAGGAAACA
ATAGTTACCTTGGGCATCCACCAGTGACGGTGGCGACCGACACGAGCATTAAATACGCTCGCCTATTCGCGGTCCACACGTCGACCGTCCAAACGCAAGC
GCATGACGCTGGTGTCGAGAGGCAGATCGTGGCCTTCCAGAGTCAATTTTCGCAACTGACGTCGACTTTGCACGGCATCCGTCTAGAGGTACGTCAAGGT
CACTACCGGTTGAAGCTCCGGGTCGACCTTCTGGACCGCCTGGTGGTAAGAGACGCGAGTTCGACCCACCGTCCTCCTCGATTACCAAGTTCGTTGCCGA
GCAGGGGTCACTCGTTGGTTATAAGTTTTCCCGTGACGCAGTCACTCCGCGGTACCGTCGTTAGCCGCATGTTCGTCGACGCGATCTTTCACGTAAGACC
CACGCGAATAGGTGATATCTTGTGATCTACATATCGCTTCAGAAGACCCACATAATATATGGGTGTGTCTTCATGTACGGCGGGATGGTGAGCCTATAAT
TTAAGTCTTTGGCTTCCTCAACCACGGTTAAACGCCCTATAAATCGCGGTAATAGTGTAGTAGTACCACCAGGTAGTACTGAAGCTGCATGTTTAAATTG
AGTGCTATACTTTATCGAACTTTTTCTCCTACACTCAAGCCTTATGATTTCTGCGACCAATTTGGTCTGCATATATTTTTGGCTTGTCCCGTTCGCTTGC
CATAGCGTCACGGATTTTACGTGTGACGGGCGATCGCTCATCCACAAAGCGTTGATCTTCTTTGAGCGCTTTTAGTATCCATCTCATCAATGACAACACC
AAGAGGTCGGTCATGGGTCGTTGATGCAAATATTTACGCATCATCGTTGCCTTGGATCACGGACCTTTTGTGTCGTGACTCCGACTTGACACTCTCTTGT
GTCATGACCACTGTGGCAATGGCAGGGTCATTGGAGAGAATTTCTGCCATCAGATTGGCGAAATCATTATGCCCTTCCGCATTTGCACCGAGCGTAGTGA
GTGGCCTCCCTCACTAAGACTCGGGCTGCGCACAAACGAGACTGGCGTCCAAGGATGGCGCAGTCCGTTTACAAAACGGTGTTTTACCCTTAA