Description :
From Genome Similarity Track
Location :
Scaffold_353:14772- 18401
Sequence
3629 bases(100 bases per row)
TAAGCACCTGCTTTCATCGTGCGAAACGTGTCAGCTTGCTCAGCATTGCCCTACCGACCAACAAAATAATAATTTCAATGTATTCAAAGATTATTATCCA
GAACCATTCTCGATCAGTAGTACTAGAGAAGAATTATGGATAAGTTGATGGGCCTGGTTCTAATAGTGTCTAAATTTGAACTCAATGCTCGAGTATATAA
GCGTGTACTATCGCTTTATATTTTTAGCAACGTTAGAATAATCGAGAGTAGCTATAGCTTGTTCGAGGAAGTAAATTTGGGCTCAACCGTAGGGTACTAA
GTATGCATTTTTTGTCGGCTTCGTGCTAGACGTAATCGTCCTCGCCTTGTCTAACATTGTTTTCGCGCAGTGACATCTCGGCCAACTAATTAAAACGAAA
AATAGCTCGCGTTTTCCCCGGTTTCGTACCTGAAACTTTAATTGGACCTATTCCAGGCGAGACTAAACACACATGACAGGTTAATTTTTTTATACTTACT
TGTCACACATAAATGCACGCTGAATGGCAAACGACCCAGTGTCGGACGCGTATTGGTGCAGTAATATAAATTATATTTCTTTCGCGTATGTTTACTGATA
TTCACCGGCAATTGTGGAACATTTATTTTGGACCTAGATTGTATATCGCTTCTATATCGAGAGTCGCTTGCTTTACATTGTGCATTCTCGGAGGGAATAT
TTCTGTCCTAAGCTTTTATCGTCCTCATTATTTTTCTTGGTTTTATTTATGCCTACTTATTATAGCCGCGTGGACAATTCAGCACTAAGCTCACAGTAAG
CCGCGCGTTCACGTGAGAGATTCCATTTTAAAAGACATTTTGGGACAGTGCAACAGTTATGGTGCCGTTTTTAGGTACGTTCTAGTACATTTCGCTGACA
AACTAGAGAATTGGGCGATTTTTGATATTTATATAGTATAGATTAGGAATGCGCTTTTGATGAAACGGACCAGTGCGCTCGAATTTTAAAAATATAAAAG
TCCAACCAATGGAGCTTCAGTACATTTTTCTGTATCTTCTGCTAGTATTAATTAACCTCGGTAATTTTACCTGCGAGGATAGTAAACTTCAAGTCATCGA
TTCGAAATGATGATTTTAAAAGCCTGATTTGCATGCGTTAAAATTAAGGAACGCACCAAAGATGAGCCGAATTAATGTCTATTGGGCTGTTCGTACTACT
TGACCGTAGCATATTAGGAATATGTCTATGTAGTATTTATTAAATACTCATCGTCTATGACACTTCGCACTATGAGTGCAAATTGTAGAGTGTATTAAAA
ACAGAGAATCCAACTGACTGCACCTACGCTACCTAGGGCCAAGGGGGAAGCCCCTGGGCTACTGTCCACTGCTCTGTGTCCAGCATAGGCAAGTGGCAAT
GCCATGTACAATGCGCACCGCCTGCTCCCTGCGATCTCAGGCTGCAGGTTGCACTGGGTATCCTGATATATGCCCACACTGCCCCCGAAACCTGTAGCTA
TGAGTCATCACTCGAACAGGAAAAGCCGGATAAATTGTCGGAGATAGACGTATCTTGAAGCAATCCGAGATCGGTGATCGCGCTGCTGTCTATATACACC
TCGACCTTGGCGGGAACGTCAGCGTAGATAGCCCGGACCGGCTCCCACGCATTCTCGATGTCTTCGAGACCAACCCAAGCGACTTGCACTTCCCACTCGT
TTATGACGGAGTTCTCGCGGTGATCGACAATCGCTCGCACCCCAAGCACTATCCCTTGTTTCGCCACATGCTTCTTGAGCTCCGTTGTCACCTCCAACGA
TGAATCGCTGTAAAACTTAAGACGCGAACCGTGCACTTCGACGTTGTCCTTCCTTACCATGTGCTCGACAGCGAAAGAGTGCGGGCGGGCCTCGTCGACA
CGAAATGAACTAGCCCAACGGACGAGTAGCTTGTTCCCTTGTAAACGCGAGTCGACTCACGCCTACAGGCCGAAATCACTCACCTCAAAGTTGCAGACGC
TGTCCTTGGCCCGCGCCATTTCGTAGAGGTGCTTCTTCTCCTTCAGTGTGGCAGCTTCCTTGTGCATAGATCGAAGGCTACGCCGCAGTTTCTCGACTTG
AGCATTCACACGCTCCGGATCCACAGGTACCAGTCGTATACCCTTTGTCGGATGGCACGGCAATCGTGTCCAGAGCTGATGGGGCTTGAAGACCCGTGAA
AACTTTGACCGGGGCGCGGTTCCCAACCAATGCAACTGGCGAATGATTCAAATTCGCCTGGATCAGAGGTAGTAGATATAACCAGTTTCTTGTATCCAGC
TGAAAGTCAAGGAGCATAACTCGGAGGACTTGCAAGATGTCCCGATTAAGGCGCTCGACTGTACCATTTATCCATGGGGTGTACACCGGGACAAACGGCT
GCTGTGCTTTCAGCCGTTCGCACAGACTCGCCATGACCTCTGACTAAATGTGAGAGCCGTTGTCGCTCTCCCATGACTCTGGTAGACCGAAACGCTTAAA
TTAGTCGAGGACGGAGGCCACCACGACATCGCTGCTGGCCGAGTCCGCTGGAACTAATTCACTAAAAAGGAGTCATCTCATCCTTGAGAGCGAGGACGTA
CTTGGTGGTGCCATACTTTTCTCCAAGGAGAAAAAAATCCATGTGAAGGCGCTCATTGCGCATTGAAACTGTACGATCCGTGGTCCACACACACGGTATG
ATCTTGCCCCCTTTCACATGCTTACAAAGGAGGCACTCGCGGATGAACTTGGCCACTTTCATTGACAGCTTCTTGATAGTGAAGCGAGCACCTAGCTGCG
CGGTCATCACATGTTCTCCTCGATGGGCTTGGACACCACAATGAACCACAATAAAAAGCCAGAGTAAGAGCGCATGTGCAGTTGGTGGGATCCAAATCCT
GCCACCAACAGTGGCTAGACCGTCATTGACAACTGCGGTTGGAGGCATCTCTTTCTTGCAACGAACTTGAATCCCTTTGATTTCAGACACACTAGGCCAC
TTGAAAGCGTCATTTTCTAACGGTTAGAGCTGTGATACGGCGCTCTCACTGCGAGTCGTCACATGATGCACCGTGGCGGTGCTTGTCGCTGCTAGCTCTG
CAGGTGGCTGCCCCCAGCGCGAAACAATATCGGCCCAAAGGTTGTGTTCGCCGGCAATGTGCTCGATTGTGTAGCGACAACCCGTAATTCGCAGAGCCCA
GCGCTGAAGCTTGCGTTTGGCATGCTGCTTGACTTCTCATCCTGGCGCAAAAAATTGGATAAGGTTAGAGTGGTCAAAATAAATGTGAAAACCCTTCTCT
CTCTCCAACAGAATATCGAGATCGCCACAGGCCTGAGCGATCGGGTAGCCCTCTTTCTCCACCACAGACCAATTTATCTGCGACTTAGTGAATGTTCCGC
CACGACACACCAAAATCTCGTCATGCTGTTCTTCAGCCGGTGTGTCTGTCGACCACTCTCGCACTTGCGTGAGGACCACGGCCCAGCCGGACGCGGACGC
GTCCAAAAACAAGCAGACATGGGCATCCCGATCAGGAAAAAAAACAACTTGCAAGAGCTCGAAAGCAGTTCCGGCACCACACGAAACGCCGATTCATCAT
CCTCCGTCCACGTGAGGTCCACACCAGCT