Description :
From Genome Similarity Track
Location :
contig_1:147715- 149684
Transcript NameFunction/comments
g24.t1hypothetical protein

Sequence
1969 bases(100 bases per row)
CGTCGGCTCACAGAGCCGACGCGTCTTCGTTACCTCGACGCCTAATGGCGGAGTGTCTTTCGACAAATTGTGTGTCGACATTATCAGTCGACACGACCGC
GTCACTCCGGACGCTTCGAGACCTTCTCGAATCCGATCGAATCAGGCCCTGCTGATTCGGTTCATATTTTCTTCCAACGACTCTCGCAGTCGTTGTTGTT
CCCTCGGGGTGATTCGAGACAGCCGCATTCCGCGCTGTCTTTGATGGAGGGACGCATGCATTACGTGGTGCATGTGCTGCTCCCGAAGTGCATGATCGTG
CGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCCATACCATATCGAACTTCTTCTCTTGATATGAGAAGCGTACACGTACGA
TACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGACTCTG
CAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACCTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGATTCGGCTTGTCA
TATTGCTTCTTGCAGTGATATTGACTCTCACTGGGGCAGCGATCTTCAATACAGCGTGTCCAATGTCGACACGCTCGACCGCATCACCAGCAGGACGCCG
GGCGCCCTGCTGGTCCCTCTAGTGTTTTGTTAGCCTGTGACGATACCCAGTATCGCCACGCGGCTCCTGGTCGCGCGCACAGGTGCTGTGCCCTCGCGGG
CGTAGTGACCGATGTGTCCGCAGCGGAAACAATGAACATTGTTGATCCATGACGCTGCTGGGAACCAGCAGCCGTCGCACCCGAGAGGTTAATTGGTTCC
GGTCCTCCCGACGGCCTTACCACCGGTCGTGGCATCAGCCGCGGGACGCTCACATGCAGTTTAGCCTCGCAGGCTAAACTCTTCTTGTATTGCGAGCCCA
ATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGTCTTCATAGGCCCATCTCTAAGGCCTTTCATGAACGTGACGACCTTTGTCGCCTCGTC
GATCGGGTTGGTCACGATGTTCGAGACCAAGTATCGTGCTCTTTGTCCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCTGCCCTC
GATCGGAACTCGTTCTGCGGGGGCTCAAACGCTTGTTTGAGCTCCTCCTTGAACACCTCGTACGCGCTGAAGCACGTAGGGTCTGTGAGTCGGCGTTCGT
ACGCCCAACTCCTTGCTCGTCCGTCAAGACATGACATGGCGAACGCAACCCTCGACAACAGGTCGACGATACGTCGAGCAGTAATGACAGTGTCGGCCTC
GACAAGCCAACGGAAGAGAGGTTCCCCCTCTCTTCCAACATAGCTGCTTACGTGGAGTGTCAATGACTCCACGCGCGGTGTGGCCGAAGGCGACACCGAA
GCTCGAGCAGTGGTTTCACGCTGCTCCTTCACGATGAAACCCAGAACAACATCGTGTTGCTCCGTCGGTGATAGCGTACACAACATCGTTGCTACCGCTG
CTTCTCCAATGACCGTCGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGATAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTTCAGACGTGTTTGG
GCTACCCACGAACATGTTACTGTCCGAGGGTGCGTTCTCAACCCCGCGTTCGTATTCCATACGAACGTGTTCTTAGTCGGTCGTTGGACGGGCTACAAAG
TGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTTAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTATTTACCTTAGATCCAGTC
TACTTGTATCCACAAGTATACTTAAACCTAGATAAAGGAACCGAACGATAGCTTTGGTGCCAAATGAGA