Description :
From Genome Similarity Track
Location :
Scaffold_15:147709- 165524
Transcript NameFunction/comments
Phypa_INRA-310PPTG_08028aspartyl protease family A22B
Phypa_INRA-310PPTG_08029phosphatidylinositol kinase (PIK-K)
Phypa_INRA-310PPTG_08030folate-Biopterin transporter (FBT) family
Phypa_INRA-310PPTG_08031hypothetical protein
Phypa_INRA-310PPTG_08032hypothetical protein
Phypa_INRA-310PPTG_08033hypothetical protein

Sequence
17815 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTCTCTCGCCGTCGTTTTGGATTATTTGATCGTATC
GGTCGTACAGATTTGACAGTAGATAGTCTTCGAAGCTTCGGATGGTTCCGATGGGGCGAAGAAGGCCATCTCGAATGCGCTTTCATTCTTCTTATGATGT
TGATGCGGAAACTTCCAAAGAAGCTGGGTGAAGTAGACAATTTTGACGAGCATCTGACGCGTTCTGTGTTGGTATGGCAGCTATTTGAACAATTCGTGGC
GTTCTACCGTCGAGTGAAATCGATTGCTTACTCTGAGACCCCGGTACCACTATCCACATTTCACGCTGGCGCTCGTTTTGGTGCAATCCATAACATTCTG
GTTACAGAGCTGAGTTCACGCACTGTGGTGGAAGAGATACACCAACAAGATACAAAATCCGGTCCAGATAATTCAACGTGTTTCACAAATCGTGACGGCG
GCGTGAAGGTTTCAGCTATGAATACAATCGTCATCAACGGCGCTAGTGCTTCAGCCGGCGATTTACATATGCGAGTGCAATTGACGGTTGGCGACCAACA
AGTAAAATGCAACGAGGTGATTCAATGTAAACTGCTGCAAACAAAACAGAAGATAAACGACGACACATATGCCAAAGAGCGAGCAAAAGCAGTGAACAGT
AGCTCGGATGTGTTTTTGCTCGTCACACCAGCTCAAGCGACCGAGTTTGCTCTTCCTCCAAGATGTGGAATTGTTTCAAGCAACGAATTTGGCCGATATT
TTGGACCGTTTGCAAGTCGCGCGTATCGAAGTTTTCTGGAGCCACCAAATATCAATACTGCTTCGTTTCATGAATTACGTCGGATAGAAGGCGTGGGTGA
CGCAACTGCCGCGAAGATTATCGCTGAGAGAAAAAAAACATCGATTCTCGAATCATGAAGATGCGTCGAATCGAGTGTTTCTAAACAAGAAAAGCAAGAC
CGCCGAGATTCTGGGCTGTATGCATTGTGATGACGCCGGAGCTGATTTGTAAGTTGATCTAGCTTGGCCGTTGTGCAAATGGACATCCAGCTGCGTTATT
CCAGATCCAAGGGAGCGCTTTTTGGCGCAAGGCGGTCATATTTCATACAATCGAAGTATCCATTTGATCGACTTCATTTTGTCTTTCCCCCAGTTCAGTG
TCATGGTTGTATGGGGTGCTTGCATTGATCGGGAGGGCAGTGCATTATATTTTGATCAATTATTCCTGAAGTAATTCGGATAGAAAAGGATAAGCAAATC
TTACCCCAATTGATTTGACGAGGGGCATTCTGGACTGCCACGGCTGCCTTCCATTTAGTGCACGCCTTTGCTCTCTTGTTGAGCTTGTGGACGATATCCT
GCCCTCGGACGTGTTTCCGCGCTGCATCTGTAATAAATACTGTGGCGTTGGTTATCTGGAGCCCAAAAAGAGGACCAGGAATTAGAAGAATGGCGTGTTC
AACGTGTTCGTCTACGAGGTGCTAGAGGGAACAACCAGTTCCTGCCAGGCGACGCAATATGTGGACCTGTTTCTACCAAACACGCAGCGAACACTGCTGT
AACATGCACGTGTGGGTCGCTGGCAAAAATGCAAACGATCACATTACGATAGCTCTACCAATATTGGGTCGACTCTAACGCAGTTACTTGGACTTCTTGT
CGTCGTCCTTCTTCTTGTCTCCGTCCTTCTTGTCATCCTGGCTATCACTGTCTTCCTCCTCATCCTCCTCGGAGTACTCGAACAGCTCCTTGAACTCGCC
ACGGACAAGTGCCGTGACTAGAGCCGAGCCCAGACAGGCAGGCACCAGGTACAGCAGTGCTGGCTGCGCGGCATTGAAGATGAACATGACGGACACTGTA
GCCACAAGGCCAAGGATGTAGAACAGCAGGTTCACGTGGAAGAATGGCTTGGCGAAAGGCTGCGAGCTGCTGGTCACGTTGGCGCGGTGTGCGTCATAGC
GCAGCAGCAACGCCACGAAGATACCAGGGATCACGATGTCGCCTAGTCCGAGGATCGAGTTCTTCTGCTTCTCTGTCTCAGTCGCAAACTCACGCGGGAA
AATGAGCTTGATAGGGGCGTCGAATGACGTGGCCACCGTGACCATGACGTCCGTACCGAAGACCCAGAAAATGTCGTAGAAGAACAAGCCGCAGAGCAGG
ATAGCGCCCACCTTAAAGCTGCCGAGCGACAGCGACTCGATGCCCTTGATGGACAACGAGATACCGAAGATGTTGTTGAGCAGGTAGTGCTTGGTCTGGA
ACCAGGCGGCAGCGAAGGCAGCAGCGAAAACGAAGGTAAGCATCCAGGACGTGGACAACTCGAGCTTGTAGACGCCGTAGAACGGGATCTTCATGTTGTG
CTTGTAGACCTTGGGGCTGCCATTGAAAAGCAGTCTCGAGATCAGAGGACTGAAGGCCTCCGTGAGACTGTAGGCACCGATAAGAGCGAAGTACGAGGTG
AGCAGAAGGTTCACCAGGTCCTTATCGAAGACCTTGAAGAGGATGTAAAGCCCCAGCAGCACGCCAGAGCCTAGAAGTGGGAACATGTATGCGTCCTCAG
CCTTCATAACCTCCTCATTCTTCTCGCCGCTGGCTTCGCGCGCGTGCTTCAGCTTGAGTGACAACGTCGAACCGATGTACACGATGGCGGACGCCGACGT
GATGAGCTGTACGGGCACGGGAATGATCACGAAGTTGGACGCCAGCATGAGAGAGATGAGCGCCACATAGCAGCCGCTTTGGATGGAGTCAATCATAGCG
AGTCGGTGGCTACAAGGGACGCGCGGAATGCGGAAGTGGAGACTGGTCTTGGAAGTTCCTGCCACGTGGAAACAACTTTTACCGCAGTGTAGTCACTACC
TCTCAAAGGTCACTGAAGCGAGTGAGCAGATGGATACACTTCCGAACAATTCTATTGTGTATGCCACATCAGAAACCGAATAAAACCGATATATCAAGAC
TTGTTACTAGTATATCGGTCTTACCAGTTTTTATTAGAGTTCTGCCTTTGCCCAATCAGAAGAGAACCAGCTTGTCGTTGGTCAAAATGAGAAAGCATCT
TGAGAGAACTGATCCTGCTCTTCAATCTACTTTTCTCGACTTTAGCGCAACGCGTTGCACGACAGTCGTCGCTCCATGGCGCCAGTAACGAGTCTACAAT
AATGAGTTTCTCTAGCGACATTTTCAGTCGACCAACAACCAAGAAACTGTGAAAAATATCAGCGCCCGTCGGTGAGGCACATCAGAGAGCAGTACCAAAA
ACCACCATGCCTTTGTTGGTTGATTACAATCGCGACGGGAACGCTCGTATCGTTGCCGCGCGAGGCACGTAACCGAGATCGGCACACTGAGAAAATCGAA
TGCGGTGATCTCTCGGCTTTGAGCGCTGCTTCGTCCAGGATGCCGTGCCAGGAGCGGCGGCGGCACTACGACGGCAGCGCTGACTCGAATGAACAGTAGT
TGCGGCTGGCTATTTGTTCCTGCGAGAGCGACAATGTGGGCCGAGCCCTGTCTTATACGAGTCGGATGTTCAGCGCAAGTAAAAGCACACACTAACCATT
GTCCTTCAAAAACAAATATCGCCGCCAGAAAAGCTGGTCCCGGGCAGATCAGCCCACCGATCAGTTATACAATAATGGACATGTTGACAACAAGTCCACC
CGAAGTGAAGGTCGCGGCCGGAGCCTGCACTGCAACCGTGCAGTCTGCACCACGCAAGACTCGAAGCATTTCGGGCCGACCATCTTCCGCCCTGCCTCAA
CCGTCGCAGGCAACGTCAGTGTGGAAGTGCTGCCGGCTGTTTCGAAGGAAGTACCAATTAATCGGTACACCCTACCCACAATCTGTCACTTCAAACATGC
ATTACCAAATCCGGGGGGTAAAACTGAAACTGACTATTGGCGTCATCAGTGAAAGGCGCAGTGCCGCGTGCGCAAACGGTGCAGATCCCTCTAATCGTCC
CGTCGCTCGCCCTAAGGTGCACCTGCGATCAAAAACAGACCAGCACCTCGTACCCATACAAAATACCGCTCCCAGTGCGCAATATTCTCTTCACCGAAGC
GAGCTATGGAGGTGACGACGATGCCCGAGGGCTCAACGCCCGTGGCGGCCGCAGCTCTCAAGCGCCTACAGATAAACGAGGACAGCAGCGACGACAATCG
TAGCGAAGATTGGGGCGCAGACGAGAGTGACTGGCGCACGTCAAGCTCGTCGGAGCCAGCGGCGCGTTTCTCGCTCATCGCTTTGCCCTCCAAAGTGCGG
GACTCGGTGTTCCGCAGAGACCGTAAGCCACAAAGGAAGACTAAAGACAGATCCAGCACCGCGGACACCACAGTCACGTCGTCCGCGAACTCCACGCCGC
GAGATTCAGAGCTCATTACGAAGACACAACAGGAACTGGAGAACGTGGAGAAATTCCGCATCTTCTGGGACGAGAAGCTCCGCAACACAATGGACAGACT
TGCAGGTACCAAAACTAAACAGACCGACGTCGAGGACGACGTTTTCCACTTGTTATTGAAGCTCTACGCCCACCAGGACGTGGTGGCACAGCTGTACAGC
AGCTACGAGGCCAACGCTGCAGAGTTCGAGTTCTACATTCCACAGCTCTGCACCTTCCTGATACATGGTAATTACGCCAAACAGCATCAGCTGGAGTGTT
TCTTGATGTCCAGAAGTGGAGATTCCTTGCCCTTTGCTCACAGATTGACGTGGTTCTTGAGATCGTTCTGCGACGACGCCAAAGAGTACCAGTCTGAGTA
CTTGAGCGTCACTGCGTCGCAGGATCAGGAGAATTCAGACTTACTTACAGCAATCGGCATGCGCGCTGGAGTACCAGCGTTGTTGATGAACAGAGGCCTC
TGTGTAGAGGAAGTGTCAGCAGCCAAGCCTCACAATCTAGAGAAGAGAAGGTCGATTATCTTCCCGACAGACAACGATCTGGACTCCTCGACTCTCGAGA
CAGACGAAACATTCGCAGGACATTTACTAAGTAAGAGGAACTCTATCCAGGATGAAGCGAGGGCAGAGGAAGGCAACTCGCAGCAGATCTTGCTGTTTAA
ACAGACCCCCAAGTTTGTGGAGGCTCTTACAGACCTGGCAGATCAGCTTATCCCGACCCCACGGCCACAGAGGAACAGCGAGCTACGCAAAGGTCTAGCC
GAGATTGAAGAGCAGATGCTCCCGTCCGATGTTATTTATCTGCCAATTGGGAACTCGTGTCACCGCGTGAAAGGCATCCGGATCGACGAGTGCTTCACGT
TCTCCACTAAAGAACGAGTACCGTACTTCTTGTGTGTGGAAGTTCTGGACTATTCAGTCCCTTCAGCATCTAAGAAACAGCGAAAGAGAAGACGATCCAA
GACGAGTCGCAATCAATCTCGAGTCTTCTCGTTGAGACTGCCTTTCAAGAAGACGGACTCCGATCTGATGGTACCAGTTGATGACTCGCCCATGTCGAGC
AGTACGTCGCCTGAGAGCGAACTGAGCTTTGTCCCGTCGCCGAGTGTTTCGTCTCCATTGCCAGAGATCGAAGAAGAGAAAAGTCTGGAAACCATGCTTG
ATGAACCGCTGGATGGTGAGGATGGGGATGATGAGAAGGAGGAGAGTAAGCGGAAATCGAGGAAGAGCTTCCAGGAGGACGAAGGTCTTCAGAGAGCTGG
AGAGGAACAACAGGAACGATTGGGCCAGTGGAACACGTCGAGACCTCGTCGACGCAGCATCAAAGAGTACTCTTCCAGCGCCTCGGCGCGCTCTGGTGGT
CAGTTTGACAGCTTTTACTCGTCCTGGTTCTCCAAGAAGGCGCAACAAGAAGCGGAAGATGAATTCAGCGCCCCTCATGCTAGCAGCATGCAACCGACAC
AGACAATCCGCAATGATGAAGAGGATGCGGAAGCAATGGAGCTTGCTCCTGTTGAGACTGACTGTACTGATGACAACACAGCATCGACTGAATCGTCTGA
AGGTGTCTTGAATGACATCGAAGTGGAACAGACTCAAGCCAGCGATGTCATTGAGGATACCACTAAAGCAGAGGCGGAAACCTACGATGCAGTGGCTACG
GAGTCAGCTACTCCGGCCGCGAATGGAGGCATTTTTTTGTCGCTGTTCTCCAGAAAGCCAAAACTTGAGGTGGTTAACGTGACCTCAAACCAACACGAGA
ATCAACCAGACGACGCTAAGGAGGATGTACCGGCCGAGAGTAAACCTGCCGAGATCGAAGCTCCAAAGACTGCTACGCCGGAAACTGCTTGTGTCGCGGC
TGCTCCGGCTCAGAGTGCAGGCATTTTCTCCGCGTTGTTTGCAAAGAAACCAACGGATGTGTCAGTTCCTGCTTCGATCCCAACTGAGACTTCTGTTGTA
GATAAGGAGCCGTCGAAGGAGGAGGCAACCGCATCGAGTAGTGAAGAGTGCAACGAAGCAAAACCTATTGTGGCTCCTGCTGCACCCGTTGGTATCTTTG
CCTCTATCTTCGCTAAAAAGCCTGCTGAAGCGACTGCTGTGGCAGCTGATATCACTGTTGCATCGATATCTTCGCTTGAGCCAAGTGAAGAGGATGTTTC
AGATGATCTCGACGCTGAAGATGCGGATGAAGAAGAGTCGGAGTCGAACGAGGCCCTTTCTTCCGATAACGACCCTGCTGACCGAACCGAGGCGTCTGTG
TCTTCGCTCGACCGCAGTGAATCGGGTATCTCGGATAGTATTGAGGCTGAAGAAGCGGACAGCGAGGATACTGACTCGAACGGAGGCTTCTTTTCAGACG
AGGAATATGCCCATGAGCCCGAACCTTCTCCTATGACGCTGCCCGCTGAAAAACCAGCTTCATTTGTATCATGGTTTTCTCGTAAGCCTACAGCTGTCGT
GGTCGAGCCAGCTCCTGAGAAGGAGGAAAACGCTACTGCAGTCACTGATACCACTACATCTTCGGAAAGTCCCCCAGATAGTGAGACTGCTGAAGCTTCA
GCACCTGTTGTTGACGACGAAAAAGACTCACAGGATGACGCTCTTTTTCAACAAAGAAAACGCGATCTAAGTGAGAGTCTCGACTTTGCTGATCCGACAG
CTTGGAAAAAGAAATTCGACCTGGAAGATGGTCTTACGGAAGAAGAACCGGATCTGGAAATGACTGACGTTGATGCAGTGGAGGAAGATGCGGACGAAGA
GGAAAACGACGCATCTGAAGATGAGAAGCCCATGATTGTCTTCCGTGAGCGATGGAGTGAGAAGGAAGCGCGCATTCGTCACGAATCTCCGTTCGGTGGC
CACCCTGGATGGCGCCTTCTCTCTGTCATTGTAAAGAGCAACGACGACCTGCGTCAGGAGCAGTTCGCAGCCCAGTTAATTGCCCAGTGTGACCGGATCT
TCCGGGAATATTCACTTCCTCTATCTCTGCGGTAAGTTTGCTATAAATCCCCACTCTGAGGATCCTCATGATTAACTCGGTTTTGCTTCCTCTCTGCCAG
ACCGTACAACGTGATCGCCACGTCAGCGAAGACTGGCCTTATCGAGGCTGTACCTGACACTGTATCGCTTGATTCGCTCAAGCGCAACGACCCAGGATAC
ACCACTCTCCTGGACTTCTACACCCGACTGCACGGCGAACAGGGAACCACTGGCTTCACCCGAGCTCAACGGAACTTTGCGGAGAGTCTCGCAGCCTATT
CGATCGTCTGCTACGTGTTCCAGATCAAGGATCGCCACAACGGCAACATCTTGGTGGACACGGACGGCCATGTAATTCACATCGACTTCGGCTTCTTGCT
CACTAACAGCCCCGGCAGTAACTGGAACTTTGAGCGTGCACCGTTCAAACTCACAGACGAGTTCGTCGAGTTGATGGGAGGTCCACGTAGCTCCACGTTC
CGGTACTTCCGATCGCTGTGTATCCGCGCGTATCTGGCCTTGCGTCGCAATATGGACCAGATTGTGCTGCTTGTGGAGATGATGCTGGTGGGGAACGCCG
ACTTGCCATGCTTTGCAGGTGGTAAGAAGGCGGTGATCGAGGGTCTTCGTGCACGACTCAAACCTGGTGCACGTACCAGCACGTGCCAAGTATTCGTCAA
CCAGCTGATCGACCAATCCATCAACAATTGGCGGACACGCTGGTATGACAAGTACCAACGAGCTTGTCTCGGAATCCTGTAAGGTGAACTGTAGCGTGGT
TGACCTCCGTTTTTTGATTTAGTAGCTATTAGCGTAGGGTAGCGTAGTAAAGAGTTGATTATAAACGAGTAGCTTTCGGAGGCATAAAAAATAATATTCT
GTTGTTTTTTTTCGGATTTCATAGTTTATGTATTGAGATACAAAATATGGATTGCAAAAGTGTTACTACCCTTCACTTTATGCTTCGTTCTAAACCTTTA
AACGACAGATGCAGATGATGTTGTGCCTTTGAGTACCACTTGTTCAGAGGGTGAGCAGGTGTCGACTCTGTGGTCCTCTCGAATGGTACCGGTGTGTTCG
TCGTCGTCCTCTTGGTCAGTATGGGCTGGCGAGCTAAAGTCCAGTTTGTCGATAATTTCTTGCGGGTCTGTTGATGGGATCAAGAAGAGGAAGAAGATCG
GCACAACCTTCAACGCACTGCGTATCACAATGGCTAGCCACAGCATCTCGTATTGGTCCTTCGTGATCCCCATCCAGTCACAGACAAAGGCCCCCCAGAA
TTCGCTCACACTGTAGGAGAGATTGGAAATGGACATAAGCAACGCGAACAGTGTACCCTCGATGCCTCTGGGGCATAATTTAGCACACAACACCATGATC
GGCATGGTTTTCAGACGACCAATGACGTCTGCCACCACGTGGTCACCCAGTACAAAGGCCTTGTCTGGGATGCCAACTTTCAGGTTGGCGCGTGTCACCA
ACACGACGTCGACGAGTGACACGAGAGCGAGACACAGCTGAGCGACCAGGAAGATCTTACGGAAGGACACGTTCGTGAAGAACGTGTTGTACAGCATTGT
CCCTGCCATGAGGAAGATAAACCCAATAGCCGAGACCGTTCCCAAAAACTCGGGTGAAAAATGCAGCACGTCCGTTGAGAAGAAGAAAAGTATCTGCGTG
TATGCAGGACTGATAGCGTGTGAGATGAACACCCACAGCGCACACATCCACACTACGGGAGTACAAATAGCAATCTTGAGCTGTCGAAGCTGCTTGGTCG
CCGAAGACACAAAGTCTCGCTTGCTTAGCGTGCTCTTGGATTCCTCCATGAACATAGAGAACAGTAGTGTCGTAATTGGTCCCAATGCAGCAGCAAAGAA
GACTCCACGCACACCTAAACCAGCCGTTGCTGGACCAGACAGGAAGGCACCGAGCATTCCACCTAGCGACGTGGCTATCCACGACAAAGACTGGAGATCA
TTCGCGCCATTTTCGGGATCTAGTCTCGAGATCTCCACAACTCTAGCGTCGATCACCACGTCGATTACAGCTACCGACAAACTTTGCAGCATGAGCATGA
GTACTGCTATAGCTGGTGTTGTGACGAGGTCAGGTACTGCCATAACTAATGTGGCTGCCGTTTGCAGGACACTACACATCATCATGTAGGACTTTCGATG
GTAGCCGAATAAAGGCAAACTGTCAGAGAGGATACCGTAGATTGGTTTCACTCTCCATGGAACTTTGACGATCATCTGTAGCAACTGCGACTGTGTCGGC
TGTAGGCCCAAGTTGTCCTTGAAGAAATAGTTGACAGCTAACGCTGTGAAGCTGGAAAAGCCCTGAACCACGTACACTACTGTGATCAGCACCAAAAACC
CAGTACCGAAGGTATCGCGTAGGTGTTGCACCCAGTTGCAAAACTGTCGGAATCTAGAGACTTTAGCGTCGCTGACTTCATCCTGGAGGTTGGATTTGTC
GACTTCCTTGGAGGGAGGTTGTGTCTTGGTCTTGGTTGTTGTCTTGGTGCTGCTGTCCTTGCTGTTGTCCGACGACGTCGTCGAGCTGGTAGTCGCGTCG
TCAATGAGCGAGGACGAACTGTCGATCGGCTCGAGGTGCTCGTCCAGATTCAACCGCGGCAGGCGCTCGGACGGGGACGCGGCAGTCTCGGGCGCCATGG
TCGACGACTGCGGGTTACAAGTGCGTGGACTCGTACCAGGCAAAACAGCTGAGTTGGCCACATGTCCTCGAACACGATGATAGCAAAGCGGATAGGAAGC
CCATGCCTCGACCAATCACCGGATCTGACTCGTTTGTTTCTCACGGTTCCTCTACGTAATAATCCTTGCGGCAAACTTTACGGAGAAAACATTTTTTGGT
GAAAAATAGCTTAGAGCTAGTAAAACTTTATCTATGTTGGGGCACTAAATAGCCTTAAAATGTTATTAATTTGTAAATAATGCACCAAACAAAGAAATAT
TATGATTCACTTTGCACTGTATGGATTTATGTCGAGAATGGATGCCATGCCGCGCTAACACGGCAGCAATATTATCAGCAAAGTAGGGTCATGCATGATC
CAGGAAGCACCAATAGGACCTTGAGCCCAGCAAAGCCTCATTAATATTCACAGTGTTTAGCGCAAACGCTTACTACTCCGTCCCATATATGCTGACCCAT
ACTACTCTTTTCTTGTCTTAAAAATGATGCCCCATAATTATATTAGCTTTCAGTACGAAACGTAGTACTATTTTTGTGGTTCTGAGACACAATCGCAGCA
ACTTCAGGAGAGCATTGCAGGCAGAAAGGAAGTCGCCCCTCCCTCTCAAGTTTATCCCTCGCCATATGTCGAGGCTTAAACGCATTGCCACCGCCGTCCT
TGATACACATGTCCATGGAGCATTGAAGACTGAGAAACGCTGCATTCAGCTTCGACGGAGGCAACTCGCAGTAAGAGTCGGCGACGGCCTCTATAAGTTC
GTCCATGGTCATTGGAGACTTCAGACGTTGACGAGCTTAAATTGCAGAGAAGAGCGAGAGGTCCAAGCAGTTGAAATCGGGCGAGTTGGGCGGATGGAAG
CAAAGCTGGACGTTAAGTCCTTGTTCAGCAACAGCAGTAGCAAACCGTTGGTCACTGGTATCTATGCGGGCGGGGGCATTATCTTGCTGCACTCTGACGC
AGCCTCCACGGCCACTAAAATGCCACTTTTCACGGATGGCAGGGAGAAGTTGTTGAATTAGTATGTTTCGGTAGGTTTCTTGGTTAACGCGCCCTTCCAT
CGTTACCAGCGTTCCAGCAGGTCGCCGGCGGCTGCTACGAACAGCAGGTTTCCGTTCGATGAATGGCCTAATGCCCAATTTCCCGTCAAAGCAGGCCCTT
GAATCGAGATCCCAACGGGGACGCACCACCGCAGCCAGCATCATCACCTTTGTGATGTAGCGCTTGGAGCGCACTTGGCGATGTGGGATAGGTTCCCCAG
GCAGTAAATAGTAGCGACGCCTAGCCTCTGTCAAATAGAACAGCATTTCGTCCACATGAATCGTATCGAACACGTCGTTGAAATAAAGGGAGTCCGTTTC
GACGTTGGAGATGCACCACCCCAACCGCTTGTGTTGAGCGGACAGCAAGAAACCCTTAAGCTTTGGAAAGCAAAAGAGCGAGTGATTCATTATTTAGTGG
GAGCTTTCCTCAATTTCCGAGTAGATCCAGTTTCTGAATATCTGGTGTCATCAAGAAGGAGAGAGAGGAAGAGCGGCCAAGCTCGTTACTCCAACACTTC
CCCGCGAGCGCTGGTTGCGAATGGTCTCACTCCGATCGACTCGCGTAGTTCACGAAATCGAGTTGTTCCCAGAGCTTTAGTTAATCCGTCGGCCAGCATT
TTAGTGGTGGGGCAATAGGTAAGTTGTAGTAGTCCGCTGGACACAGCGTCGCGAATCGAGAAGAAACGACAATCGACGGTCTTCTGGGCCTCCGAAATTT
TACCGTTGGAGAGTCTCTTGATGGTGGACTTGTTGTCCATCATGGCAGGGATTGCAGGCCCATCTTGGGATCTCGAAAGCCGCTCCACGAGCATTTTCGT
CCATACGGCTTCCTCAACACCGTCGTCAGCTGCCAGGTACTCCGCTATTGTGGATGATTTAGAGACTATTCGCTGTCGTTTCGTTTGCCAGGATACGGGA
CACCCAAATACCTGAACCAGGACGCCCGACACCGATTTCGGATCTTCTTCGTTGTTTGCCCAGTCTGCGTCAGTGAAGACGCGAACTGGAACTGTATCAG
CGTTTCGACGATAAATCAATCCCAATCGGGTGGTTCCAGCAATGTATTTTGACTACCAACAGTGCAACTTGGAAGGGTCGGACGCCTGTTCAGCCACTTG
GCTTACGGTGTATGCGATGTCTGGTGACCCGAGAAAGATAAAGTAGAGCTCCAACCGCCTGACGATAAGGAACATCACCGGCAGCTTCTTCATTCTGGGT
ACGTCGGTACAGAATGATGCCTTGATCCATCGGTGTCTTCCGGGGTCTGCAATTCTCCATCCCGAAACGGCGAAGAACTTCGAGCGCAAACTGAGATTGG
TTTAGGGTAGTTGTCTGTAGTTTGTTATCCATTTTAACTCGAACTCCAAGGAACCAATTGATTTCACCGAGGTTCTTGACTCCGTATTTCTCATTGAGAG
CTCGCAGTAAACTGACCATTTCAGCTTCCTCTTGATATCCGATAAGGATGTCTACATAGATCAACACAACCAAACCGTTAGTAGAATGGATATACACGCA
AGGATCCTCACGAGTAGGGGTTTAACCAAGTTCGACAAGGAATCCGTTGATCTCCCGGTTCCACTCTCGGCCAGCATGCTTTAGACCGTATAAAGCTTTT
TTGAGTCGCCAAACCTTTGACCGATTACCTTCTTCAAACCCGCGAGGCTGTCTCACGTAAATTACTTCGGACTGTCCAGCGTTGACGTAAGCCGTAGGTA
CATCCCCTTGGCGAACGCGCATATCCATTTGGGTCGCCATTGCAAGAAACACGCGGATTGAGTTTAACTTGGTCACAGGAGAGTAGGTTTCAAAGTAGTC
CTTAAGAAACTCCTGCGTAAAGCCCTGGGCACATATTCTGGCCTAGAAACGCTCCACTTCCCCGGATCGGTTTAACTTCACACGATAAACAAAGGTTGAT
CCAACAACGTGCGCTCCTGGGGGCGGATCGACAAGTTCGAAAGTATCATTGGCCTTCAGAGCAGCGATTTCATCTTGGATAGCCTTCTCCCAGCGTACCC
ATTCAGTAGATGCTCGAGCTTCTTTCAAGTTTACGGACTCTTGAATGACTTCGTGTAAGGCTACGTGAGCCGCACTGAGAGCCGTACCGACAGCTTGACT
AGAGAGACGCTCCGACCGACGATGAAGAGTCAATCCAACAGAACCATTGTATTCGGCCACTTGCGCTGGGTTCAGCGAGGGTCCGACGTTCTCTTGTTGG
TTGTCGCCCTTGGCTTCATTCTCTCCCGAATTCAGTCCGTCATTGACTATGCGGTTCATATTGGTAGACGTCAGGTCATCTTTGTCATCTTCCCCGACAA
TCCTGAGCGGGTCCTCCTGTGGAGAAAATGAAGCAGGAATGGGTTGAAGACTGGGAGGTTCTAGAAAAACAACGCTCCGGCTGTGAACAACTCGATGACC
TGGTCCAGATACGTAGACAAAGTATCCTTTGCGTTCAGGGTCACTCCCCAGGAAGATACCCGTCCTCCCTTTGGGCCGGAACTTGTACTGAGTTGACCGT
TTTTTTCAGGAGGTATGAGTACTACACACCGTTGTCCAAAGGGCTTGATCAGCATCAGGTCAGTTTTGCGTCTCCAAAACTTTTCAAACGGAGTTTTCTC
CTTGTCCATTTGGGACAGCACTCTGTTCCTAGAATATACAGCCCTTCTGACTGCATATTCCCATAAGTGGTGGGGAAGCTTGGCTTGAATGAGTAGGGCT
CGAGCCGCATCAGACAAGGTGCGATGTGTGCGCTCAACGACACCGTTCTGGTGGTGAGCCTCGGGCTCCGACATCTCCACCGTTATCTCCTCATGACAAA
CTTCGCGGAAGTCATCGGCTACAGACCCCCACCATTGTCGGATCGGTAGATTCGGAAGCGATCTTGCTCCTTGAAGCGACGGTTCACAATCTTGACGAAC
TCCCGAAAACAACGAGTGGCTTCACTTTTCTTCTTAATAAAGTAGACGGTAGAATGCCCTTTCCATTTCTAGGCATAGTAGAATCTGTTGCCATTGTAGC
TCCTTTGGAAGGGTCCAGCAAGATCACCATGGCATACTTCGTCTTGGGCACAGATCGGTCGAGAGGCCTGGCGGGGTGCAGGAGCACGAGTGATTTTGCT
CATCGCAGACTTCACACCTTTCTGAGGGCGTGAGCGGGCCGACGACGTTGAGGCCCTTAACTGCGTTCGATTTGTTCAACTCGACAATGGACTTGTAGTT
CAGATGTTCTAGTCGTTGATGCCAGTCCTCTATAGAATTGGGTCGGAGGGCGGCCGAGGCCATGCCAGCGGGCATATCCAAAGAGTAAACTCCACGACAA
GCAGATCCTTGGAGAACAGGTTTATCATAAATCAAGCAGTGCTCGTCCGTAAATTTCACCCTTTCATCCCTAGATCGATGAGTTTCTTTACAGAAATCAA
CGTTCTCCTCAGGCCAGGGGCATAGACGACATTGTCAAGCACCACATTATTGAGTTTGCCCAGTATCATTTTTCCCATCTGGTTACCACAGATGAGATCG
CCATCAGCAATTTCAATTGCGTGAGTTTCACAAGGCTTAAGGTCGTGAAGGAGCTCACGTGATCCAGTAACGTGATAACTGGATCCAGAGTCGATGATCG
GGGCGTCCTTGAAAATCCCAGGGTCAAAAATGTTTGTCCTGGTTTTCAACGACTCCCGCGACCCTCATTCCCGAGGTTCAGAGCTTTCGTCGCCGTCTTG
GGCATCTTCGCATTCATCCGTTTCAGCTTCTTCATGGAATTTGGCGATTGAAGAGCGAGCAGCATTCGCCATACCACTTCGCTTGAGTTGAACGTACTTA
TCGTGATAGTTCGTGGTGTGCCCAAGCTCTCCGCAGGTATCGCATCGCGCTTTAGAGAAATCACGACGCTTAGTTTTTCCGTCACCATTGAAGGTAACCC
TCCTTTTTCCGAGGATGGACTCGGATTGACTTCCGTCGACGCTGGAAATACGGGGCGAAGCTCCAGTAGGGCGCGACTGACTCGACTTTGACAGTGGGGG
CTTCTCAATTCCTTGATGGCCAGCGATGGAACAGAGTTTCTGAATGGCTCTATCGATTTCACGAATCGGGTGGTCAGAGTCCTCACGAACAACCAGACGA
AGGCTGTCCGCATGCTTAAACCACGCATTGGCAATGAATGAGCTGAGGGCAGCATTTTTCGACTCGCAGGTCTCCAACCCGTGGGTAGTGGCCGTTGCTG
CCATGGCTCGAAGTCACAGAGAGTATTCTCGATATCTCTCAGTATGCCGCTTTCTCTCACTGGCTACTCTTAGCACTATCTGCTGGTTGGACAACTTCCA
GCTGAACTCAGCTCTTATGTCCTCACAGACTCGCTCAAACAGGCTCGTTCTCAGATAGCGTACGTTTGCTACGTACCACTAACTGGCTACGCCTCGGAGA
TGCTGAAAAGGGAGAGCATTTCTCAGTCGATCCAGCAGTACCAGGCTATGAAGATCTTCCTGAGTACAAAGCAGGGCTTCAAAGCGCGTAAGTCAGAGAG
AAATGCCCGAGCCAAGAGCTCCGGGTTGGGGCGTGCCATCGAATTCTTCGATCTTGTAACTCTTGATCACCCGATCGTACCGGGCCGCGTTGGTGTTTAC
TCGGTTGTGATCACGATTGTTTTCATCACGCCCCGCATCTCGAGGATTCTCGCCCCGAGCTGGGCTCATGCGTTCGGCAGCAGGAGGAATCCTCCGAGGA
AGAGGAGGGATCCCCTCATTGAAGGCACCGGCAGGTTCGTCACCATTGGGTTGCTGATCGCCGAGTGCTTCTTGACGTTGGGGCACATTTGAATCCATAT
TGCAGTGACCGGAAAAGATAAGCAGAGCTTGGGGCTGTTAACCTGTTGAGCGGACAGCAAGAAACACATAAGCTTTGGAAAGCAAAAGAGCGAGTGATTC
ATTATTTAGTGGGAGCTTTCCTCAATATCCGAGTAGATCCAGTTTCTGAATATCTGGTGTCATCAAGAAGGAGAGAGAAGGAGAGCGGCCAAGCTCGTTA
CTACAACAGCTTGGCCTTGTTCACGTCCGTGAGCAACGGTTTAACGGTGTTCACATGAGCCACAACTTGGCCGCTTTGTATGCGACGATGTAGCGTGATT
CGTGACACACCAGAGTCTGCAGATGCTGATTTCAGGGTGCTTCGTTGTGCCAACGGGGTGTTACGTAGCCTCTCTATCTTGGCGGAGAGATCCTCTTGGG
GCGGCCGCGCTGGTGGTGGTGGGAAGGAGAGCGTTGGACGCCTGTCCTGCCTTGTTCCTCCTTGGCTCGCTTCCACAACCTTGCCAACGTCTTGCGGTCG
ACACAGAACTTAGCCGCAACCTCCTTCATGGCGCCCGTGCGAGGAACGTCTTCAACCGACCGTTTCAACAGCTCCGCGACCGCGTCTTCTCTCTCGTTGT
CACTAAGCTCGCGCCGCTTCTTCGTGGGGGTGTGCGATGGCATTATGTCCTCAATATAGAATTGAATAAAATGTCAAATATAGCGAAGCTGGGCGATATC
TATCATCTATACCCCCCTCTCCCAGGTCATATAATGCCCCCTCAGCCGCTCATTTTACTAAATCGAGGTCAATATGAACCGGTTTGACTAAATGAGCACA
CGGTTTGGACCGCGC