Description :
From Genome Similarity Track
Location :
Scaffold_16:147684- 153654
Transcript NameFunction/comments
Physo_131488pol protein
Physo_131489hypothetical protein

Sequence
5970 bases(100 bases per row)
CTTCCTCTGACGCAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCGACACCTGAGTCTGTATAGACTGACCCTCTGTGGATAATG
GAGCAGTTCGCTCACTTACTCCCGAACCAGCAGGATGCGCTTAAAAAGCTTATGTCCTTGCTGGGCCCGGAGGGCGTGATGTAACTTGCGCAGCAAGGCC
CCGACGCGGTGAACGCGCGTCTCGAGGCGTTTTCAAGCTACGAGAATGCTCTCCTAGAGCACCTCCAGCAGAGGATGGCAACGGCCGCGGCGCCCCAAAC
GCCCGCTTCGTCATCTGACGCGGAAACAAGACCCAAGCCGCTCATGTTGAGCGTGAAGACCTTCGAAGGCAAGGAGGGTGAAAGCTTGATGCTTTGGACC
CGTGAGGTTGAGATGGCTATGAGCTCAGCTCTACTCCGGACGGAGTCGCAGCGCGTGGCACTAGCTATCTCGAAGCTCGATGGGCGAGCGAGAGAGTGGG
CACTAACGTCCGGGACGTCGGACGAGGTGGCCTTCCCGACGTGGGACCAGCTGAAACAGCAATTGTCCCGAGTGTTTGCCCAAACGAGGCGTATCGTGTG
CGCTTACGCTTCCTGGCGACCAGGCAGAGCAAGAAGGAGTTGGTGACTATGTCCAAGAGTTGAGAACTCTCATTGCTGGTATGTCTGCGGACCCCCTGCC
GGAGGCAGTCACCGTTACGGTGTTCATGGAGGGCATCCGCACTAGCTTTACCAGGACGGAGGTGTTCCGAACCCACTCGAGCTCTTTAGAAGAGGCTGGG
AGCGTCGCATTGAATGCGGAGCACAACTTTAAGCCGTCGAGACTTGGGTGGAATGCGTCTTACGCTAGCGCGTCGAGTGGTCCGGAACCCATGGACCTCA
GCTATGCTGAAGACGAAGAAGCCGAGCTTCGTGCTGCTGTGCAGCGTCGCGGTATGCACAGATGCTTCATCTGTGGTGACACCCGTCACCTTCGTGCTGG
GTGTCCGCTGCGCCATCAGCGCCAGGCTTCGTCAAGCCGCTCCTCGAGTTCGATCCAGGGCTCTGGTTTGTCTCGGGGAAACGAGAAGTCCCAGTAGGCG
CGGGGCGGCCTACTGGGGAAGAACTAAGTTCTATTGAGCCTCGGCGAGGTGGAGGTCGACAGGACTTAGCCCCGAAGAGAGCCGTACTCTCTAACACGGA
ACGTGTATGCAAGCCGGGCTTGCTAGTTGTCCAAGCTTGGGTGAAGGGCTTCACCAAGCCATGGATGATTTTGATCGATTCGGGAGTGTCGGGTAACTAC
GCCCGGCGTTCTACGATGGACGGAAGTCAGCTTTATGCTGAGGCGCTGGTAGCGCGCGGAAGTGACATCGTCACTGTTCGTCTCGCGACGGGCACTCGTG
TCACGGTGCCAAAGGTCCCTGTGGACCTGGGCGTGAAGTTTTTGGATTTTGATAGCGTTGAACGCTGTCTGGTCTTAGACCTCGATTCGAGATATGATCT
CATCCTTGGTATGGCGTGGCTGGAACGCCACGAGCCTTGAATCGATTGGAGGTCGAAGACCCTTGGTGCTACGCACTTCTCTCCTGGAGGAGCATTGGCG
AGTCATGAACCCACCTCTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCACTGGACCGAGTCGGTCAATGTGCTGGACATCGGAGTTTCCGAGTTGGTGG
ACACTGAGTGTGTCGAGAACGAGCGTTCCGAGCGTGACTCGCGGACGGCAGGTGGAGCGGTACGAATTCCGCTGAGCGGGCGTGCGTCTGAGGGCGACGC
CCTGCTGCGTGCCGGTGAAGGCGCGGTCGACAGGAAGTCGAGTGAAGATGGGCGTTGCCCGGATCAAGGATGTGGAGCGGCACTAATTCCGCTGAGCGGG
CGTGCGTCTGAGGGCGACGCCCTGCTGCGTGCCAGCGACGGCGCGGTCGGCATGATGCCGAAGAACAAGGGGCTTTGCCCGGATGAAGATCGTGGAGTGG
CACGTAATCCACTGAGTGGAGGCTGCGGATCGTGCAGCTCTTCGCTGAGTGCCGGTAAAGACACTGGAGCTCTCCCCGAGCTGAACGAGGTGGTGACACC
TGGCGTCAAGACGCACGCGAAATCACGGAGCTCTTCAGGGCGGACGGTGTCCATGAAGAGGAGGCAGCGCCGCAAAGCGCTGGCTGCGAGACGCAAGGCG
TCTGCGATCTCACGAGTCGAGAAGGGCGTGTCGAGCGGCGAGGCTCCACGCGAGAGCGAGCAGCTCTATACACTCGTGAATGGAGTGACGGGCGACGTCG
ACGGAGGTATCAACCTCGACGACTTGCCCTCACTGTCTGCTCTCCTGGAGCTGGACGAGATGTCCTTGTCCAAGTTCGGCGAAGCCTTGAAGGCTGGAGA
CTAGGCCGAGGTAGTGGTCATACGACCCGAAGATGAATTGAACTCGTCCTCGCTTCTGGATGAAGCTGTCCTGGAAGACACCAAGAAGACGCTGAATGCG
CGGAGCGGATCGGCGATCCTGAAGGACCCGTCGGATCCCTTGTATCAAGTGGTAAATTATTACCAGGACGTGGTCTCGAAGGAGCTGCCCTCGGGGCTAC
CTCCGGATCGAGGTGTTCGACACGAAATCGATCTCGTTCCGAGAACGAAGTACTGCGTGACGAGGCAGTGGCCCTTGCCGAAAGAGCAGTGTGACGTCAT
TGACGCGTTCTTCCGTGCGAAGCACGAGGCGGGCATGGTGCGTGAGAGTAAGTCTCCATACTCTACGCCGACGTTCTGTGTCAGAAAGACGAATGGCAAA
TGGCGTATCGTGCATGCTTTCAACAAGCTGAATGCCGCTACCATCTCGGTGCAGACGCCGATTCCTCGGAAGGATGTTCGTCAGAACAACATGACAGGAT
GTACGATGTACAGTGCGCTCGACTTGGTCGATGGATATTACCAATTGCTCATGAGGACGAGCGACATCCCTCTCACCGCGGTGAGTACTCCGAGCGGCAT
GCTCTGGGAGTGGTTGGTGATGCCCCAAGGGCTTTCGAACGCGCCGGCGACGTTTAATCGTCTTGTGACGCAGCTCTTCAGGCCCCATCGGGCGTACGCG
CAAACGTACTTCGATGACATTTTTGTCCACAGTCGTGCGGAGCACGGAAAGACTGATATGGAGAACCATGTCGAGCACCTGCGTGCTGTGCTCGAATGCA
TGCGTCAATACAAGTTGTACGCCAACATTGACAAATGCATCTTCGGAGCGGAAGAGATACCCTTCTTAGGGTGCTTCATCGGGAAGCGTGGCCTGAGGGC
CGACCCGGTCAAAGTCAAGGCCATTGTTGACTGGCCGGTTCCCAAGAACCAAAAGGATCGTCGCAAGTGGCTTGGCTTGGCCAATTACTTGCACAAGTAC
AGCGAGAACTACGCTGAGATGGCTCGGCCACTCTCCAATCTCCTGAAGAAGGGTGCGGAGTGGTGTTGGAACACCGAGCATCAAGATGCGTTCGCGGCCA
TTAAGGACAGTCTCCTTTATGCGCCTATTCTGGCTCTGCCAGACCCCGCTCGTCCGTTTAGTGTCGTCTGTGACGCCTCGGACTTTGCCATCGGCTGTGC
ACTGCTGCAAGCAGACGCCGAGGGGCGCGAGCGCGTGGTGGCGTTCGAATCTCGCCAGCTGAAGGATGCGGAGAAGAACTATCCTGTCCACGACAAAGAG
CTACTTGCGATGAAGTATGCGCTCGTCAAGTTCAAGGTGCACCTGCTGGGCTCTCAGCCGTTCGTGATTTACACGGATCATGCGTCGTTACGCACTGCGA
CTCAGTCGCCTCGCCTCTCGCAAAGGAAGGCCCGTTGGCCGTCCTTCTTCGCGGAGTACAACTTCGAGGTGAAGTACAAGCCTGGCAGGCAGAATGTCCT
TGCGGACGCGCTGTCGCGCAGGCCGGATTATGAGCTGGCTCATGTAACGACCGTGACTTCGTCATTAACGGATTTGATCCGAACGGCTTATGCCAAGGAC
GACACCTGTGTCGCGTTGCTGAAGGCTCTGGGGAGCAAGGAATTTCAAGACTCGGACATGGAATTGTCAGCGCGGCTGCGCGCGCGGCTACACCGCTATT
CCCTCCATGGTGGCCTGTTGTTCTACAACACTGGCCCCGAGGATACGCCCCGCGTGGTCGTCCCTCATGATGAGGATCTGAAGTACCGCATCCTCTATGA
GGCACACGACACGCCGCTGGCCGGCCATCTTGGCCGTGAGAAGACCTACAGCTCGGTGAGGACCCACTACTGGTGGCCGAAGCTGTACAAGTGGACGAGC
ACTTATGTGCGCACGTGCGAGACGTGCCAGCGAGTGGAGTCGTCACCTCATGCTGCAGCGCCGTTGGCGAATTTGCCTGTCCCTTCGGGCTGTTGGCAAT
CCATGAGTATGGACTTTGTGTTTGGCCTGCCGGCGGACGCGGCGGGCAACACTGGTGTCGTGGTCTTCGTGGACCGACTGAGCAAGATGGCTCACATTGC
GGCTGTGCCGGATACCATCGATGGTAAAGGTACAGCAACGCTGTTCTTGGACCGAGTGTTTCGACAACACGGACGCCCAGAGTCGATTTTCTCGGACCGA
CACCCCCGCTTCACGGGCAGCTTCTGGAGCGCGGTCTTTGCGGTGCTTGGCACCAAGCTGGACATGTCCACGGCGGACCATCCGCAGACCGATGGTCAGA
CAGAGCGCGTGAATCGCGTCGTCGAGGACGTGCTCCGCAGCATTTGCGCCAAGACGCCGAAGCGCTGGAGCGCCATGCTGCCACTCGTTGAGTTCGCGTT
GAACAACGCCGTGCACGCCTCGACAGGCTACACGCCGTTCTACGTGAACAGTTTGTCTCATCCCCGCGTCCCGCTGACGCCGCCACGTGGTGGCATCGGG
CTTGGTGGGGGAGGAGAAGCCGATTTAGCTGATCGGCTAGCCGATGTCAGTCCGGCTACTATTCGTAAACAGGTTGACGCTTTCTTGTCGACGCGTCTGA
GTGTCTTACGACATGTGCCTGACGCAATGGCTGAGAGCCAAGACAAGCAAAAGGAACATGCAGATGCCAGGAGCAGAGGCAATGTTGAAAGTTATGAGGT
CGGGGACCTGGTGTTGCTTAATGCTAAGAACCTACCTACACATGCAGTGTCTGCCGTCTTCAAGACGAAGTTGCGCCCGCGCTTCATCGGACCTTTCAAG
GTTGTGGCCAAGAAGGGCCTTGCGTACACGCTCAATCTTCCGAAGAAGATGCGGACGCACCCCGTCTTCTACGTGGGCTTGCTCAAGCAGTACCAGGACC
CGACGCAGGTGCAGATGGAGGCACCGAGGGTGACGAGGTCACATGCGCGGAGGTCGCGGTCGTCGAGGACGCGGTCGCAGGCGTCGAGGACGCGACCACT
CACGTGGGCACCGCAGGCACAGGCGGAAGAATCGGCGCCGGAGGTGCCGCGGGCACAGCGGGAGCCGCAGGCGCAGGAGGCGCGGCAGTCGGAGCCTGCA
TGCGGGCCACGAGGTTGAGCTGACCCTGAAGCACAGCCTGCTGACGCTGTAGCTCCCCGAGCTCCCAGCCACGTTGCTCATCGCGAACGCGATAGTATCG
CACCCAGTCCTCCAGGGCCCCAAGGCGGTCCCAGACCGCTCGAGGCACCTCGATCCATCGCGTCCGCTCGGCGAGCTCGTCGAGTTCGGTGGCAGTCCGG
ACCAGACGTGCATCGTCGTCATGGATATGATCCCGAAGGCGACCCGCCTGCTGCCTCACCTCCAAGAGTTCACTTTGAGTCGCAAAGGACCCCACAGCGG
CCTCCACCGGCCCTGCTCGATGAGCATGAGAATCTACATCACCATGGGGAGCGCCTCCTGGCGAAGCGGCGGTGCCGGGGTCAAAACCAGTATCTGGTGA
AATGGCGAGGGTACCCTCACTCCGAGAACTCATGGGAGTTTGAGGTGCCCCTCTGCCAAGACTGCCCAGA