Description :
From Genome Similarity Track
Location :
Scaffold_580:14766- 16977
Transcript NameFunction/comments
Phymu_g10968hypothetical protein PHYSODRAFT_351929

Sequence
2211 bases(100 bases per row)
AATTATCTTTTACTTCGAGTAAGTTACCCAACAAATTCTTTCACCAATTGCAGATGTTTGTGGTCGGGtgctgcatcgtcgtcgacgtctccagcaccgc
aaAGGACGTGGTAACGTTGTCCATCCCAAAGTTGCCGAAGTCACTGATCCCCCCTTCGCTCGTGTCTACCATCGCCGCCTTGCCAGTGCAGTTGTTGCCA
ACGTAGAAGGCAAGTTTTACCTGCTGGTCAGCGATGGTTGATCCTTTAATCGGAAGCCCTGCCCAACGAGCGGAGGAGATACTGTCACTTAAATCGGAGC
ATGGCATGTCGTAGCAGAGATTCCCTGCGGAAACGCCAATGATGCGACGAAGTCTCTTGAAATCCGGTTCCTTGTAGATCCGCAACTCGCCTTGCATTGC
CCTCGCTGTTTCGACACTGCAAGCGAGCGCAACAATGACAGagaacagcagcgctggcACGAGGCGAGAAACCATCGGTCGATGTCCAGTTGCACTGTGA
ATTGAAGACTGAGCAGTGTTTCAGGTGAACCGCAGGGTCGAATATTTCAGCACAGCCTTCCACCACGAGATCAAGACCGTGTTGTCCTCGTATGACCCGA
GCAGCTACGTTTCACGGTTAAAGTCCACACCAATGCGGCTTATAGTTTTAAAATCCTGTGCTACTGCTAATTGTACATGTGCGTGCATGGATCTCCACTC
AACACGACACGAATTCTCCCGCAAAGAAGAGGTTTTTCATGCCTCGAAAGGCCCCCCATGTACGAGaaaagaagaacatgaagatTGATCCGAATTCTCC
ATCACGCGACAGATCTTGGTCGTTGCCCAACTCCCGGATGCACTGTTGGTAGTGCTCTACATTCGCCCCTCCTGGGTGTTCGGACGGGGCGTACGAGAGT
CCACCGTGAGAGAAGGATTCCGTGAGTGACTCGATATTCCAGCAGCTATCGGACACGAGACGTCGACGCACCCCGTGGCGGCTAAGCAGGTGTGAGAGAT
AGTAATCATCGCCGAGGTAGCAAGCCTTGGACATATCGGCCACCTTGAACGCCGGCATCGTTTCTTCCTCCATCCCGAAGAATTTGCGTTTAACTGCGac
gcctcctgctcctcctaCGAACGAAACACTGTTCACGCCGACCGCCAAACTCCGTCCACAGTACAGTCCGTCCTCCGCTGAGATCCAACCGCCCAGCACC
GCAATCGCGTCATCCGGGTACTTGTGCGTGTAATGCAGCGCTCGTTCACACAACTGAGGAGGGTACACcctgtcgtcgtcaccatACACGATGATGGTGT
CCGGGTCCTGTTCCACTAAAAGAGTCCCCAACACTTTACTCGCCGGTCCAAAATCAGTGTCCAGCACGATGAGTCGCAGTTTGGCATGGTACGGACTCGA
CCCGGTGGCGAAGGTGATGCCACGGAATTCGGTCCGGTTCAACGTCGCGTCATCCTCCAGAAGCCACGACGGGATTTCCACCGCTTTTTCTCGGTACATC
CGAGGGACGATGACATACACCgcgtcgaagccgtcgccCTCTTGTTGCACCAACGCATCCACCGTAGGCTGCATCTCGTTGATTCCCCTTGGAGTCGTag
tgaagctgaagacaacACGCGGTCGCGCCTGTGCCGCACTCATGGAGGAAGTTGCTCTGGGAGTGGACGAAtggaaggagaagaggaagagcacgatCCA
AGCGACggaagtggccaagaagcacgcAAACCACCGCTTCCGTCTGCTAAGGTCGTCTTCGGGGAGCGTGGAAGACTCCAGGACGATTTTCTCCGGCAAT
AGCTTGGCCAATTGACGGGTCCgtcgccgacgccgacggtgccgaacgagaaggaaCGTGAGGGCCGACAGCCCCGTGAGCAGTGAAAGCAGAGAAATCC
GTGGGATCATGACCTTTTCCGCGTACAAATCGATGCAGGCGTCGCCGACAGACGTCCGCAATGACTGCGTGGCCATTTTCTTGGTGTTTTGGATGGCGGC
AACGAGTTGGCAAGTGGAAATGTGCCGTCGATACAGTATTGAGATTCATCGGCCGCTGTCGCACGCTTCATTGGCATTGGATGGTGCCGGCATTGAAGAC
ACGATGCGACAGACTCGGCCAGCTGGCACTAGGATTGTGTGCGAAAGATCAAGTTTTCTGAAGTAAACAAGTTTTGATATAACCTTTTGGAGTTCGTGTA
GAAAGGAGTTA