Description :
From Genome Similarity Track
Location :
Scaffold_145:147653- 149489
Sequence
1836 bases(100 bases per row)
ACGAGGAACCTATCGCTTGACACTTTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGATCATTCGCAGTCCTGGCCCAGACATGGTGCG
TCGTACACCATCGACCTGCCAGAGTCAATGCCGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGGGACTTTGACCCGCAGGGGGTTACTGACTCGC
AAACCCCCTTGCCCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGATGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGC
GGTCAAGACCGTACGCCGGAGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGG
AAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGAATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCA
CCCGCAGGTGCAGGCTCGCAACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACC
GCCAGTCCCAAGGCCAAGTGCAATCTTAAGCACGAGGACACGCTGACGGAGGCGGTCAACCTCAGGGCCCTGTGTCGGACGCGCAGTCGGAGCACTCAGA
CGGGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAGGTCCACTTCCACGTGAAGCGG
ATCCTCCAGGAGCAATGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCC
TGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGATGAA
TACATTCCGTCCCGTGCGCATTGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATGCGCTTGTTGACCAAGTGGGCAATCCTCACACG
AAGCTCATGCTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTACTCAAGAGTCGACACCCATGCCCAGAAC
ATGTCCTCACAAGTACTCCACGTGGGACAATTTTCGGGCATAACCCAGGGGTATCCCCAAAGCGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACAAC
AAGTCGTGAAGTCCTTAAGAGGGATGCGGTGTGGCGCGAGACGCACGCACCGAGCAGACTCCATGTTGTCAACGAACAACTGTTCTTTCTGAGCAAGGGC
ACGTTCGTAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACAAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGC
CAATACCCTCTCGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACACACTGGGCAGCTTGGAAATCCTCCTGCTGCTGGT
CGATGTCATTCGAGACCTCCCCAGGCTCAGTGATAGCACCCTTCTCCTCCTCTTCTTCCGAGGAGTCGAAGATACTCTGATAGGAGTGTCGAGTCTTCTT
CTCCTCGCGGAGTGGAGACTTAGAAACTGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAACACGCGCAAGACCCTTGGCAAGCGAG
AGACGTTCGCGAAGATTCTCTTCCTCATCGCCACCG